ID: 1186796061

View in Genome Browser
Species Human (GRCh38)
Location X:13047617-13047639
Sequence CTTGAAAAGCCCACTGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186796061_1186796065 11 Left 1186796061 X:13047617-13047639 CCCTTCTCAGTGGGCTTTTCAAG No data
Right 1186796065 X:13047651-13047673 TTAGATTATAATTCCTTCAAGGG No data
1186796061_1186796066 15 Left 1186796061 X:13047617-13047639 CCCTTCTCAGTGGGCTTTTCAAG No data
Right 1186796066 X:13047655-13047677 ATTATAATTCCTTCAAGGGCAGG No data
1186796061_1186796064 10 Left 1186796061 X:13047617-13047639 CCCTTCTCAGTGGGCTTTTCAAG No data
Right 1186796064 X:13047650-13047672 ATTAGATTATAATTCCTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186796061 Original CRISPR CTTGAAAAGCCCACTGAGAA GGG (reversed) Intergenic
No off target data available for this crispr