ID: 1186798243

View in Genome Browser
Species Human (GRCh38)
Location X:13067063-13067085
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186798237_1186798243 16 Left 1186798237 X:13067024-13067046 CCTGGTCTGGTGGCAGAGGGAAG No data
Right 1186798243 X:13067063-13067085 CAGTTGGAACTGTTTGACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186798243 Original CRISPR CAGTTGGAACTGTTTGACCC TGG Intergenic
No off target data available for this crispr