ID: 1186799979

View in Genome Browser
Species Human (GRCh38)
Location X:13083194-13083216
Sequence CTGTGAAATGGGAAAGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186799979_1186799983 3 Left 1186799979 X:13083194-13083216 CCTTCCTCTTTCCCATTTCACAG No data
Right 1186799983 X:13083220-13083242 ATCGTTGAATAAATGCAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186799979 Original CRISPR CTGTGAAATGGGAAAGAGGA AGG (reversed) Intergenic
No off target data available for this crispr