ID: 1186799983

View in Genome Browser
Species Human (GRCh38)
Location X:13083220-13083242
Sequence ATCGTTGAATAAATGCAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186799982_1186799983 -9 Left 1186799982 X:13083206-13083228 CCATTTCACAGAAAATCGTTGAA No data
Right 1186799983 X:13083220-13083242 ATCGTTGAATAAATGCAAGCAGG No data
1186799976_1186799983 23 Left 1186799976 X:13083174-13083196 CCCAGTAAGTAATATTTCCTCCT No data
Right 1186799983 X:13083220-13083242 ATCGTTGAATAAATGCAAGCAGG No data
1186799981_1186799983 -8 Left 1186799981 X:13083205-13083227 CCCATTTCACAGAAAATCGTTGA No data
Right 1186799983 X:13083220-13083242 ATCGTTGAATAAATGCAAGCAGG No data
1186799978_1186799983 6 Left 1186799978 X:13083191-13083213 CCTCCTTCCTCTTTCCCATTTCA No data
Right 1186799983 X:13083220-13083242 ATCGTTGAATAAATGCAAGCAGG No data
1186799979_1186799983 3 Left 1186799979 X:13083194-13083216 CCTTCCTCTTTCCCATTTCACAG No data
Right 1186799983 X:13083220-13083242 ATCGTTGAATAAATGCAAGCAGG No data
1186799980_1186799983 -1 Left 1186799980 X:13083198-13083220 CCTCTTTCCCATTTCACAGAAAA No data
Right 1186799983 X:13083220-13083242 ATCGTTGAATAAATGCAAGCAGG No data
1186799977_1186799983 22 Left 1186799977 X:13083175-13083197 CCAGTAAGTAATATTTCCTCCTT No data
Right 1186799983 X:13083220-13083242 ATCGTTGAATAAATGCAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186799983 Original CRISPR ATCGTTGAATAAATGCAAGC AGG Intergenic
No off target data available for this crispr