ID: 1186801048

View in Genome Browser
Species Human (GRCh38)
Location X:13092672-13092694
Sequence CTTCTCACCGCAGCACTTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186801048_1186801056 25 Left 1186801048 X:13092672-13092694 CCACAAAGTGCTGCGGTGAGAAG No data
Right 1186801056 X:13092720-13092742 ACATTCCACCCACAGCTCTGAGG No data
1186801048_1186801053 1 Left 1186801048 X:13092672-13092694 CCACAAAGTGCTGCGGTGAGAAG No data
Right 1186801053 X:13092696-13092718 CCTGCCCTCAAGTCTTGGTTGGG No data
1186801048_1186801051 0 Left 1186801048 X:13092672-13092694 CCACAAAGTGCTGCGGTGAGAAG No data
Right 1186801051 X:13092695-13092717 CCCTGCCCTCAAGTCTTGGTTGG No data
1186801048_1186801049 -4 Left 1186801048 X:13092672-13092694 CCACAAAGTGCTGCGGTGAGAAG No data
Right 1186801049 X:13092691-13092713 GAAGCCCTGCCCTCAAGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186801048 Original CRISPR CTTCTCACCGCAGCACTTTG TGG (reversed) Intergenic
No off target data available for this crispr