ID: 1186801050

View in Genome Browser
Species Human (GRCh38)
Location X:13092695-13092717
Sequence CCAACCAAGACTTGAGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186801050_1186801060 15 Left 1186801050 X:13092695-13092717 CCCTGCCCTCAAGTCTTGGTTGG No data
Right 1186801060 X:13092733-13092755 AGCTCTGAGGAAGCTCCGTCTGG No data
1186801050_1186801061 16 Left 1186801050 X:13092695-13092717 CCCTGCCCTCAAGTCTTGGTTGG No data
Right 1186801061 X:13092734-13092756 GCTCTGAGGAAGCTCCGTCTGGG No data
1186801050_1186801056 2 Left 1186801050 X:13092695-13092717 CCCTGCCCTCAAGTCTTGGTTGG No data
Right 1186801056 X:13092720-13092742 ACATTCCACCCACAGCTCTGAGG No data
1186801050_1186801062 17 Left 1186801050 X:13092695-13092717 CCCTGCCCTCAAGTCTTGGTTGG No data
Right 1186801062 X:13092735-13092757 CTCTGAGGAAGCTCCGTCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186801050 Original CRISPR CCAACCAAGACTTGAGGGCA GGG (reversed) Intergenic
No off target data available for this crispr