ID: 1186801052

View in Genome Browser
Species Human (GRCh38)
Location X:13092696-13092718
Sequence CCCAACCAAGACTTGAGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186801052_1186801060 14 Left 1186801052 X:13092696-13092718 CCTGCCCTCAAGTCTTGGTTGGG No data
Right 1186801060 X:13092733-13092755 AGCTCTGAGGAAGCTCCGTCTGG No data
1186801052_1186801062 16 Left 1186801052 X:13092696-13092718 CCTGCCCTCAAGTCTTGGTTGGG No data
Right 1186801062 X:13092735-13092757 CTCTGAGGAAGCTCCGTCTGGGG No data
1186801052_1186801056 1 Left 1186801052 X:13092696-13092718 CCTGCCCTCAAGTCTTGGTTGGG No data
Right 1186801056 X:13092720-13092742 ACATTCCACCCACAGCTCTGAGG No data
1186801052_1186801061 15 Left 1186801052 X:13092696-13092718 CCTGCCCTCAAGTCTTGGTTGGG No data
Right 1186801061 X:13092734-13092756 GCTCTGAGGAAGCTCCGTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186801052 Original CRISPR CCCAACCAAGACTTGAGGGC AGG (reversed) Intergenic