ID: 1186801053

View in Genome Browser
Species Human (GRCh38)
Location X:13092696-13092718
Sequence CCTGCCCTCAAGTCTTGGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186801045_1186801053 26 Left 1186801045 X:13092647-13092669 CCTACAACGCACAGCACAGCTCC No data
Right 1186801053 X:13092696-13092718 CCTGCCCTCAAGTCTTGGTTGGG No data
1186801047_1186801053 5 Left 1186801047 X:13092668-13092690 CCTGCCACAAAGTGCTGCGGTGA No data
Right 1186801053 X:13092696-13092718 CCTGCCCTCAAGTCTTGGTTGGG No data
1186801048_1186801053 1 Left 1186801048 X:13092672-13092694 CCACAAAGTGCTGCGGTGAGAAG No data
Right 1186801053 X:13092696-13092718 CCTGCCCTCAAGTCTTGGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186801053 Original CRISPR CCTGCCCTCAAGTCTTGGTT GGG Intergenic