ID: 1186801055

View in Genome Browser
Species Human (GRCh38)
Location X:13092701-13092723
Sequence ATGTGCCCAACCAAGACTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186801055_1186801062 11 Left 1186801055 X:13092701-13092723 CCTCAAGTCTTGGTTGGGCACAT No data
Right 1186801062 X:13092735-13092757 CTCTGAGGAAGCTCCGTCTGGGG No data
1186801055_1186801056 -4 Left 1186801055 X:13092701-13092723 CCTCAAGTCTTGGTTGGGCACAT No data
Right 1186801056 X:13092720-13092742 ACATTCCACCCACAGCTCTGAGG No data
1186801055_1186801061 10 Left 1186801055 X:13092701-13092723 CCTCAAGTCTTGGTTGGGCACAT No data
Right 1186801061 X:13092734-13092756 GCTCTGAGGAAGCTCCGTCTGGG No data
1186801055_1186801060 9 Left 1186801055 X:13092701-13092723 CCTCAAGTCTTGGTTGGGCACAT No data
Right 1186801060 X:13092733-13092755 AGCTCTGAGGAAGCTCCGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186801055 Original CRISPR ATGTGCCCAACCAAGACTTG AGG (reversed) Intergenic
No off target data available for this crispr