ID: 1186801056

View in Genome Browser
Species Human (GRCh38)
Location X:13092720-13092742
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186801052_1186801056 1 Left 1186801052 X:13092696-13092718 CCTGCCCTCAAGTCTTGGTTGGG No data
Right 1186801056 X:13092720-13092742 ACATTCCACCCACAGCTCTGAGG No data
1186801055_1186801056 -4 Left 1186801055 X:13092701-13092723 CCTCAAGTCTTGGTTGGGCACAT No data
Right 1186801056 X:13092720-13092742 ACATTCCACCCACAGCTCTGAGG No data
1186801054_1186801056 -3 Left 1186801054 X:13092700-13092722 CCCTCAAGTCTTGGTTGGGCACA No data
Right 1186801056 X:13092720-13092742 ACATTCCACCCACAGCTCTGAGG No data
1186801050_1186801056 2 Left 1186801050 X:13092695-13092717 CCCTGCCCTCAAGTCTTGGTTGG No data
Right 1186801056 X:13092720-13092742 ACATTCCACCCACAGCTCTGAGG No data
1186801047_1186801056 29 Left 1186801047 X:13092668-13092690 CCTGCCACAAAGTGCTGCGGTGA No data
Right 1186801056 X:13092720-13092742 ACATTCCACCCACAGCTCTGAGG No data
1186801048_1186801056 25 Left 1186801048 X:13092672-13092694 CCACAAAGTGCTGCGGTGAGAAG No data
Right 1186801056 X:13092720-13092742 ACATTCCACCCACAGCTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186801056 Original CRISPR ACATTCCACCCACAGCTCTG AGG Intergenic