ID: 1186801060

View in Genome Browser
Species Human (GRCh38)
Location X:13092733-13092755
Sequence AGCTCTGAGGAAGCTCCGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186801052_1186801060 14 Left 1186801052 X:13092696-13092718 CCTGCCCTCAAGTCTTGGTTGGG No data
Right 1186801060 X:13092733-13092755 AGCTCTGAGGAAGCTCCGTCTGG No data
1186801054_1186801060 10 Left 1186801054 X:13092700-13092722 CCCTCAAGTCTTGGTTGGGCACA No data
Right 1186801060 X:13092733-13092755 AGCTCTGAGGAAGCTCCGTCTGG No data
1186801050_1186801060 15 Left 1186801050 X:13092695-13092717 CCCTGCCCTCAAGTCTTGGTTGG No data
Right 1186801060 X:13092733-13092755 AGCTCTGAGGAAGCTCCGTCTGG No data
1186801055_1186801060 9 Left 1186801055 X:13092701-13092723 CCTCAAGTCTTGGTTGGGCACAT No data
Right 1186801060 X:13092733-13092755 AGCTCTGAGGAAGCTCCGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186801060 Original CRISPR AGCTCTGAGGAAGCTCCGTC TGG Intergenic
No off target data available for this crispr