ID: 1186801062

View in Genome Browser
Species Human (GRCh38)
Location X:13092735-13092757
Sequence CTCTGAGGAAGCTCCGTCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186801050_1186801062 17 Left 1186801050 X:13092695-13092717 CCCTGCCCTCAAGTCTTGGTTGG No data
Right 1186801062 X:13092735-13092757 CTCTGAGGAAGCTCCGTCTGGGG No data
1186801054_1186801062 12 Left 1186801054 X:13092700-13092722 CCCTCAAGTCTTGGTTGGGCACA No data
Right 1186801062 X:13092735-13092757 CTCTGAGGAAGCTCCGTCTGGGG No data
1186801055_1186801062 11 Left 1186801055 X:13092701-13092723 CCTCAAGTCTTGGTTGGGCACAT No data
Right 1186801062 X:13092735-13092757 CTCTGAGGAAGCTCCGTCTGGGG No data
1186801052_1186801062 16 Left 1186801052 X:13092696-13092718 CCTGCCCTCAAGTCTTGGTTGGG No data
Right 1186801062 X:13092735-13092757 CTCTGAGGAAGCTCCGTCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186801062 Original CRISPR CTCTGAGGAAGCTCCGTCTG GGG Intergenic
No off target data available for this crispr