ID: 1186801160

View in Genome Browser
Species Human (GRCh38)
Location X:13093438-13093460
Sequence TGGGGGCCCCAGGAGTCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186801160_1186801173 19 Left 1186801160 X:13093438-13093460 CCCTGAGACTCCTGGGGCCCCCA No data
Right 1186801173 X:13093480-13093502 AGGGGCAAACTCTTCCATGCAGG No data
1186801160_1186801169 -1 Left 1186801160 X:13093438-13093460 CCCTGAGACTCCTGGGGCCCCCA No data
Right 1186801169 X:13093460-13093482 AGATGGATCCTCTGAGGCTGAGG No data
1186801160_1186801171 1 Left 1186801160 X:13093438-13093460 CCCTGAGACTCCTGGGGCCCCCA No data
Right 1186801171 X:13093462-13093484 ATGGATCCTCTGAGGCTGAGGGG No data
1186801160_1186801164 -7 Left 1186801160 X:13093438-13093460 CCCTGAGACTCCTGGGGCCCCCA No data
Right 1186801164 X:13093454-13093476 GCCCCCAGATGGATCCTCTGAGG No data
1186801160_1186801170 0 Left 1186801160 X:13093438-13093460 CCCTGAGACTCCTGGGGCCCCCA No data
Right 1186801170 X:13093461-13093483 GATGGATCCTCTGAGGCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186801160 Original CRISPR TGGGGGCCCCAGGAGTCTCA GGG (reversed) Intergenic
No off target data available for this crispr