ID: 1186808122

View in Genome Browser
Species Human (GRCh38)
Location X:13160592-13160614
Sequence CTCTTTCTGAGACAGATGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186808122_1186808126 2 Left 1186808122 X:13160592-13160614 CCAGACATCTGTCTCAGAAAGAG No data
Right 1186808126 X:13160617-13160639 ATGAGGCAGAAGGTTCCACTAGG No data
1186808122_1186808125 -8 Left 1186808122 X:13160592-13160614 CCAGACATCTGTCTCAGAAAGAG No data
Right 1186808125 X:13160607-13160629 AGAAAGAGGTATGAGGCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186808122 Original CRISPR CTCTTTCTGAGACAGATGTC TGG (reversed) Intergenic
No off target data available for this crispr