ID: 1186810977

View in Genome Browser
Species Human (GRCh38)
Location X:13188119-13188141
Sequence CTGTAGGTACAGGATGAGTA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186810971_1186810977 -5 Left 1186810971 X:13188101-13188123 CCCCCACAGAGTCTGAGTCTGTA No data
Right 1186810977 X:13188119-13188141 CTGTAGGTACAGGATGAGTACGG No data
1186810972_1186810977 -6 Left 1186810972 X:13188102-13188124 CCCCACAGAGTCTGAGTCTGTAG No data
Right 1186810977 X:13188119-13188141 CTGTAGGTACAGGATGAGTACGG No data
1186810973_1186810977 -7 Left 1186810973 X:13188103-13188125 CCCACAGAGTCTGAGTCTGTAGG No data
Right 1186810977 X:13188119-13188141 CTGTAGGTACAGGATGAGTACGG No data
1186810975_1186810977 -8 Left 1186810975 X:13188104-13188126 CCACAGAGTCTGAGTCTGTAGGT No data
Right 1186810977 X:13188119-13188141 CTGTAGGTACAGGATGAGTACGG No data
1186810970_1186810977 -2 Left 1186810970 X:13188098-13188120 CCACCCCCACAGAGTCTGAGTCT No data
Right 1186810977 X:13188119-13188141 CTGTAGGTACAGGATGAGTACGG No data
1186810969_1186810977 -1 Left 1186810969 X:13188097-13188119 CCCACCCCCACAGAGTCTGAGTC No data
Right 1186810977 X:13188119-13188141 CTGTAGGTACAGGATGAGTACGG No data
1186810967_1186810977 12 Left 1186810967 X:13188084-13188106 CCGGTTCTTGGGCCCCACCCCCA No data
Right 1186810977 X:13188119-13188141 CTGTAGGTACAGGATGAGTACGG No data
1186810968_1186810977 0 Left 1186810968 X:13188096-13188118 CCCCACCCCCACAGAGTCTGAGT No data
Right 1186810977 X:13188119-13188141 CTGTAGGTACAGGATGAGTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186810977 Original CRISPR CTGTAGGTACAGGATGAGTA CGG Intergenic
No off target data available for this crispr