ID: 1186815914

View in Genome Browser
Species Human (GRCh38)
Location X:13238017-13238039
Sequence CTTCACATGCAGATGGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186815914_1186815923 19 Left 1186815914 X:13238017-13238039 CCCACCTCCATCTGCATGTGAAG No data
Right 1186815923 X:13238059-13238081 CCAACAGTCATCCAACTAGAGGG No data
1186815914_1186815921 18 Left 1186815914 X:13238017-13238039 CCCACCTCCATCTGCATGTGAAG No data
Right 1186815921 X:13238058-13238080 CCCAACAGTCATCCAACTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186815914 Original CRISPR CTTCACATGCAGATGGAGGT GGG (reversed) Intergenic
No off target data available for this crispr