ID: 1186816120

View in Genome Browser
Species Human (GRCh38)
Location X:13239653-13239675
Sequence GACACAGAAGTGACTTCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186816118_1186816120 22 Left 1186816118 X:13239608-13239630 CCAAATAAAAATGAATCTGTCCT No data
Right 1186816120 X:13239653-13239675 GACACAGAAGTGACTTCAGCAGG No data
1186816119_1186816120 2 Left 1186816119 X:13239628-13239650 CCTAAACAGTCTAATGAACAAAA No data
Right 1186816120 X:13239653-13239675 GACACAGAAGTGACTTCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186816120 Original CRISPR GACACAGAAGTGACTTCAGC AGG Intergenic
No off target data available for this crispr