ID: 1186824496

View in Genome Browser
Species Human (GRCh38)
Location X:13325787-13325809
Sequence CTGCATATTCATCTGTTGCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186824496_1186824500 13 Left 1186824496 X:13325787-13325809 CCGAGCAACAGATGAATATGCAG No data
Right 1186824500 X:13325823-13325845 TTATAGTCTTATCTATCACCAGG No data
1186824496_1186824501 20 Left 1186824496 X:13325787-13325809 CCGAGCAACAGATGAATATGCAG No data
Right 1186824501 X:13325830-13325852 CTTATCTATCACCAGGTTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186824496 Original CRISPR CTGCATATTCATCTGTTGCT CGG (reversed) Intergenic
No off target data available for this crispr