ID: 1186826444

View in Genome Browser
Species Human (GRCh38)
Location X:13344891-13344913
Sequence GTTTTCTTCTAGGAGTATTA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186826444_1186826446 3 Left 1186826444 X:13344891-13344913 CCGTAATACTCCTAGAAGAAAAC No data
Right 1186826446 X:13344917-13344939 GCAAAAGCCTTCCTTGACGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186826444 Original CRISPR GTTTTCTTCTAGGAGTATTA CGG (reversed) Intergenic
No off target data available for this crispr