ID: 1186835166

View in Genome Browser
Species Human (GRCh38)
Location X:13430326-13430348
Sequence CTCTAGACACAGGGGAAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186835160_1186835166 -5 Left 1186835160 X:13430308-13430330 CCACGAATGGGTCACCTGCTCTA No data
Right 1186835166 X:13430326-13430348 CTCTAGACACAGGGGAAGCTGGG No data
1186835152_1186835166 27 Left 1186835152 X:13430276-13430298 CCCTTAGCAGGTATTCTCTTTGG No data
Right 1186835166 X:13430326-13430348 CTCTAGACACAGGGGAAGCTGGG No data
1186835154_1186835166 26 Left 1186835154 X:13430277-13430299 CCTTAGCAGGTATTCTCTTTGGT No data
Right 1186835166 X:13430326-13430348 CTCTAGACACAGGGGAAGCTGGG No data
1186835159_1186835166 2 Left 1186835159 X:13430301-13430323 CCATTGGCCACGAATGGGTCACC No data
Right 1186835166 X:13430326-13430348 CTCTAGACACAGGGGAAGCTGGG No data
1186835158_1186835166 3 Left 1186835158 X:13430300-13430322 CCCATTGGCCACGAATGGGTCAC No data
Right 1186835166 X:13430326-13430348 CTCTAGACACAGGGGAAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186835166 Original CRISPR CTCTAGACACAGGGGAAGCT GGG Intergenic
No off target data available for this crispr