ID: 1186839522

View in Genome Browser
Species Human (GRCh38)
Location X:13471211-13471233
Sequence AAGGAAAAGCAGAGTAAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186839518_1186839522 -4 Left 1186839518 X:13471192-13471214 CCACGTGCAAAGTGTGATGAAGG No data
Right 1186839522 X:13471211-13471233 AAGGAAAAGCAGAGTAAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186839522 Original CRISPR AAGGAAAAGCAGAGTAAGGA GGG Intergenic
No off target data available for this crispr