ID: 1186842074

View in Genome Browser
Species Human (GRCh38)
Location X:13494387-13494409
Sequence GCTGTTCAGTGGATTGTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186842066_1186842074 21 Left 1186842066 X:13494343-13494365 CCTCGGCACTATTGACATTTGGG No data
Right 1186842074 X:13494387-13494409 GCTGTTCAGTGGATTGTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186842074 Original CRISPR GCTGTTCAGTGGATTGTAGA AGG Intergenic
No off target data available for this crispr