ID: 1186844809

View in Genome Browser
Species Human (GRCh38)
Location X:13520141-13520163
Sequence ACAGCGAAAGGTGGGACTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186844809_1186844814 25 Left 1186844809 X:13520141-13520163 CCTCTAGTCCCACCTTTCGCTGT No data
Right 1186844814 X:13520189-13520211 AAGGTTCCATGACTTACCCAAGG No data
1186844809_1186844815 26 Left 1186844809 X:13520141-13520163 CCTCTAGTCCCACCTTTCGCTGT No data
Right 1186844815 X:13520190-13520212 AGGTTCCATGACTTACCCAAGGG No data
1186844809_1186844813 6 Left 1186844809 X:13520141-13520163 CCTCTAGTCCCACCTTTCGCTGT No data
Right 1186844813 X:13520170-13520192 AAAGAAATTGAGATTCAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186844809 Original CRISPR ACAGCGAAAGGTGGGACTAG AGG (reversed) Intergenic