ID: 1186844811

View in Genome Browser
Species Human (GRCh38)
Location X:13520150-13520172
Sequence TTTGTCTGTACAGCGAAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186844811_1186844813 -3 Left 1186844811 X:13520150-13520172 CCACCTTTCGCTGTACAGACAAA No data
Right 1186844813 X:13520170-13520192 AAAGAAATTGAGATTCAGCAAGG No data
1186844811_1186844814 16 Left 1186844811 X:13520150-13520172 CCACCTTTCGCTGTACAGACAAA No data
Right 1186844814 X:13520189-13520211 AAGGTTCCATGACTTACCCAAGG No data
1186844811_1186844815 17 Left 1186844811 X:13520150-13520172 CCACCTTTCGCTGTACAGACAAA No data
Right 1186844815 X:13520190-13520212 AGGTTCCATGACTTACCCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186844811 Original CRISPR TTTGTCTGTACAGCGAAAGG TGG (reversed) Intergenic
No off target data available for this crispr