ID: 1186844812

View in Genome Browser
Species Human (GRCh38)
Location X:13520153-13520175
Sequence TTCTTTGTCTGTACAGCGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186844812_1186844815 14 Left 1186844812 X:13520153-13520175 CCTTTCGCTGTACAGACAAAGAA No data
Right 1186844815 X:13520190-13520212 AGGTTCCATGACTTACCCAAGGG No data
1186844812_1186844814 13 Left 1186844812 X:13520153-13520175 CCTTTCGCTGTACAGACAAAGAA No data
Right 1186844814 X:13520189-13520211 AAGGTTCCATGACTTACCCAAGG No data
1186844812_1186844813 -6 Left 1186844812 X:13520153-13520175 CCTTTCGCTGTACAGACAAAGAA No data
Right 1186844813 X:13520170-13520192 AAAGAAATTGAGATTCAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186844812 Original CRISPR TTCTTTGTCTGTACAGCGAA AGG (reversed) Intergenic