ID: 1186844813

View in Genome Browser
Species Human (GRCh38)
Location X:13520170-13520192
Sequence AAAGAAATTGAGATTCAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186844806_1186844813 18 Left 1186844806 X:13520129-13520151 CCACCCTGGGCTCCTCTAGTCCC No data
Right 1186844813 X:13520170-13520192 AAAGAAATTGAGATTCAGCAAGG No data
1186844812_1186844813 -6 Left 1186844812 X:13520153-13520175 CCTTTCGCTGTACAGACAAAGAA No data
Right 1186844813 X:13520170-13520192 AAAGAAATTGAGATTCAGCAAGG No data
1186844809_1186844813 6 Left 1186844809 X:13520141-13520163 CCTCTAGTCCCACCTTTCGCTGT No data
Right 1186844813 X:13520170-13520192 AAAGAAATTGAGATTCAGCAAGG No data
1186844807_1186844813 15 Left 1186844807 X:13520132-13520154 CCCTGGGCTCCTCTAGTCCCACC No data
Right 1186844813 X:13520170-13520192 AAAGAAATTGAGATTCAGCAAGG No data
1186844808_1186844813 14 Left 1186844808 X:13520133-13520155 CCTGGGCTCCTCTAGTCCCACCT No data
Right 1186844813 X:13520170-13520192 AAAGAAATTGAGATTCAGCAAGG No data
1186844811_1186844813 -3 Left 1186844811 X:13520150-13520172 CCACCTTTCGCTGTACAGACAAA No data
Right 1186844813 X:13520170-13520192 AAAGAAATTGAGATTCAGCAAGG No data
1186844810_1186844813 -2 Left 1186844810 X:13520149-13520171 CCCACCTTTCGCTGTACAGACAA No data
Right 1186844813 X:13520170-13520192 AAAGAAATTGAGATTCAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186844813 Original CRISPR AAAGAAATTGAGATTCAGCA AGG Intergenic