ID: 1186844815

View in Genome Browser
Species Human (GRCh38)
Location X:13520190-13520212
Sequence AGGTTCCATGACTTACCCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186844811_1186844815 17 Left 1186844811 X:13520150-13520172 CCACCTTTCGCTGTACAGACAAA No data
Right 1186844815 X:13520190-13520212 AGGTTCCATGACTTACCCAAGGG No data
1186844810_1186844815 18 Left 1186844810 X:13520149-13520171 CCCACCTTTCGCTGTACAGACAA No data
Right 1186844815 X:13520190-13520212 AGGTTCCATGACTTACCCAAGGG No data
1186844809_1186844815 26 Left 1186844809 X:13520141-13520163 CCTCTAGTCCCACCTTTCGCTGT No data
Right 1186844815 X:13520190-13520212 AGGTTCCATGACTTACCCAAGGG No data
1186844812_1186844815 14 Left 1186844812 X:13520153-13520175 CCTTTCGCTGTACAGACAAAGAA No data
Right 1186844815 X:13520190-13520212 AGGTTCCATGACTTACCCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186844815 Original CRISPR AGGTTCCATGACTTACCCAA GGG Intergenic