ID: 1186845889

View in Genome Browser
Species Human (GRCh38)
Location X:13530719-13530741
Sequence ATTAGCAATGCAAATCCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186845887_1186845889 24 Left 1186845887 X:13530672-13530694 CCTCTGATTTCTTTTTAGGTAGA No data
Right 1186845889 X:13530719-13530741 ATTAGCAATGCAAATCCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186845889 Original CRISPR ATTAGCAATGCAAATCCTGC TGG Intergenic
No off target data available for this crispr