ID: 1186849736

View in Genome Browser
Species Human (GRCh38)
Location X:13569008-13569030
Sequence CTGCCTACCATGAAGCCAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186849734_1186849736 -1 Left 1186849734 X:13568986-13569008 CCAAGGTGTGGGGTCATAGTGTC No data
Right 1186849736 X:13569008-13569030 CTGCCTACCATGAAGCCAAAGGG No data
1186849729_1186849736 11 Left 1186849729 X:13568974-13568996 CCAAGTCCAAAGCCAAGGTGTGG No data
Right 1186849736 X:13569008-13569030 CTGCCTACCATGAAGCCAAAGGG No data
1186849733_1186849736 5 Left 1186849733 X:13568980-13569002 CCAAAGCCAAGGTGTGGGGTCAT No data
Right 1186849736 X:13569008-13569030 CTGCCTACCATGAAGCCAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186849736 Original CRISPR CTGCCTACCATGAAGCCAAA GGG Intergenic
No off target data available for this crispr