ID: 1186849780

View in Genome Browser
Species Human (GRCh38)
Location X:13569376-13569398
Sequence GTTGAGAAGTCGAAGCAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186849780_1186849782 -5 Left 1186849780 X:13569376-13569398 CCATCCTGCTTCGACTTCTCAAC No data
Right 1186849782 X:13569394-13569416 TCAACTAAATTCTTAAGTCCTGG No data
1186849780_1186849783 3 Left 1186849780 X:13569376-13569398 CCATCCTGCTTCGACTTCTCAAC No data
Right 1186849783 X:13569402-13569424 ATTCTTAAGTCCTGGAGTGCAGG 0: 1
1: 0
2: 1
3: 14
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186849780 Original CRISPR GTTGAGAAGTCGAAGCAGGA TGG (reversed) Intergenic
No off target data available for this crispr