ID: 1186855124

View in Genome Browser
Species Human (GRCh38)
Location X:13618941-13618963
Sequence GTAGATGCTTAGTTTACCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 74}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186855123_1186855124 4 Left 1186855123 X:13618914-13618936 CCTAGTATGAAGGGATGTATCAA 0: 1
1: 0
2: 1
3: 20
4: 151
Right 1186855124 X:13618941-13618963 GTAGATGCTTAGTTTACCCAAGG 0: 1
1: 0
2: 0
3: 3
4: 74
1186855122_1186855124 10 Left 1186855122 X:13618908-13618930 CCAAAACCTAGTATGAAGGGATG 0: 1
1: 0
2: 0
3: 2
4: 106
Right 1186855124 X:13618941-13618963 GTAGATGCTTAGTTTACCCAAGG 0: 1
1: 0
2: 0
3: 3
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186855124 Original CRISPR GTAGATGCTTAGTTTACCCA AGG Intronic
905594701 1:39196455-39196477 TTAGATGCCTAGTGTACTCATGG + Intronic
908377832 1:63563073-63563095 TTAGATGCTGATTTTACACATGG - Intronic
918713572 1:187761962-187761984 GTACATGGTTACTTGACCCATGG - Intergenic
920113320 1:203602244-203602266 GTAAATTCTTGGTCTACCCAGGG - Intergenic
922989627 1:229895432-229895454 GTAGCTCCTTAGTCTACTCAGGG + Intergenic
924543076 1:244999674-244999696 GTAGTTCCTTACTTTATCCATGG + Intronic
1064638971 10:17396410-17396432 GTGGATGCCTAGTGTAGCCATGG - Intronic
1074563471 10:114554905-114554927 GTGGTTGCCTAGTTTGCCCAGGG - Intronic
1078904643 11:15672367-15672389 CTAGATGCCAAGTTTACCCCAGG + Intergenic
1080241110 11:30128201-30128223 CCAGATGCATAGTTTACCCCAGG - Intergenic
1086809828 11:91295435-91295457 GTAGATATTTAGTTTTTCCAGGG - Intergenic
1096562067 12:52442866-52442888 GTAGATGCCTAGTTTAGGCGAGG + Intergenic
1100259188 12:92915861-92915883 GTATATGCTTAGTTTTCTTATGG + Intronic
1101577032 12:106007187-106007209 ATAGATGCTGAGTGTTCCCAGGG - Intergenic
1106419528 13:29574169-29574191 GTAGGAGCTTAGTTTACAAAGGG + Intronic
1107034553 13:35886933-35886955 GTAGATTCTAAGCTTCCCCATGG + Intronic
1108081986 13:46746548-46746570 GTAGACTCTTAGTTTGCCCATGG - Intronic
1108285390 13:48902077-48902099 TTAGATGCATAGTATACCTAAGG + Intergenic
1111805367 13:93033752-93033774 GAATATGCTTAGTTTCCCCTAGG + Intergenic
1112874258 13:104015843-104015865 GTAAATGGTTAGTATTCCCAGGG - Intergenic
1116656018 14:47654757-47654779 GAAGGTGCTTAGATTACCAAGGG + Intronic
1116824762 14:49661839-49661861 GTATATGCTTAGTAAACCAAAGG - Intronic
1117932841 14:60863260-60863282 GTAGATGCATAGCTTACCTGGGG + Intronic
1119055200 14:71412415-71412437 TTAGAGGTTTATTTTACCCACGG + Intronic
1124610825 15:31207184-31207206 GTAGAGGCTTAGTCTTTCCATGG - Intergenic
1126574521 15:50183857-50183879 GTAGATGCTTTTATTACCCCGGG + Intronic
1132949389 16:2552380-2552402 GAAAATGCCCAGTTTACCCATGG + Intronic
1132964960 16:2647792-2647814 GAAAATGCCCAGTTTACCCATGG - Intergenic
1142841386 17:2633898-2633920 GCAGATGGTAAGATTACCCATGG - Intronic
1144008245 17:11120940-11120962 TTCAATGCTTAGTTTACACAAGG - Intergenic
1144891720 17:18498063-18498085 GGACATGCTTAGTTAAGCCAAGG - Intergenic
1145140502 17:20446254-20446276 GGACATGCTTAGTTAAGCCAAGG + Intergenic
1153675270 18:7451493-7451515 GTTGATTCTTAGATTACCCATGG + Intergenic
1155927890 18:31677517-31677539 GTAAATGCTTAATTTTCCAAAGG + Intronic
1156126363 18:33910422-33910444 GCAGATGCTGTGTTTCCCCATGG + Intronic
1158842636 18:61404605-61404627 GTAAATCCTTATTTTACCCGTGG - Intronic
1162850196 19:13425268-13425290 GTAGATGCTCAGGTTACCTCTGG - Intronic
928008475 2:27584373-27584395 GAAGGTGCTTAGTTTTTCCATGG + Intronic
929475724 2:42245945-42245967 CTAGATGATAAGTTTACTCAGGG + Intronic
931430929 2:62208563-62208585 GTAGATGCTTAGGATACTTATGG + Intronic
933505661 2:83174351-83174373 GTAGATGTTTTGTTTACAAATGG + Intergenic
937540045 2:122938228-122938250 GTAGATGTTTTATTAACCCAAGG + Intergenic
939334258 2:140804885-140804907 GCACATGGGTAGTTTACCCATGG - Intronic
940216303 2:151307171-151307193 GAAAATGCTTAGTATCCCCAAGG + Intergenic
944945329 2:204677734-204677756 GGAGATGCTTAGTTGACCACAGG - Intronic
944987309 2:205192025-205192047 GTACTTCCTTAATTTACCCACGG + Intronic
945163356 2:206916312-206916334 TTAAATTCTTATTTTACCCAGGG + Intergenic
1177903757 21:26949945-26949967 GTAGATGATTAGATTAAACACGG - Intronic
1183087067 22:35492891-35492913 GTACATGCTGAGTCTTCCCAGGG - Intergenic
957544423 3:81619194-81619216 CTACATGCATAGTTTAGCCATGG - Intronic
967314227 3:188136121-188136143 GTTGATGCTTACTATAACCAAGG + Intergenic
976995110 4:91421955-91421977 TTAGAAGCTTAGATTACCCTTGG + Intronic
979808921 4:125011553-125011575 ATAGTTGCTTTCTTTACCCATGG + Intergenic
983459810 4:168014243-168014265 GTGGATGCCTGGTTTTCCCAAGG + Intergenic
983779408 4:171649776-171649798 GTAGATGCTTTGATTCCACAGGG + Intergenic
983920377 4:173337541-173337563 GTAGATGCTTGGCTCACCTAAGG + Intergenic
993134991 5:83949766-83949788 GTAGATGTTAACCTTACCCAAGG + Intronic
995407539 5:111816596-111816618 GTATATCCTTAGTCTACCCTAGG - Intronic
996038795 5:118787654-118787676 GAAGATGCTTTCTTTCCCCAAGG - Intergenic
996826482 5:127687623-127687645 CTAGACACTTAGTTTACTCATGG - Intergenic
1000515321 5:162231568-162231590 GTAGATTCATAGTTTATCCTTGG + Intergenic
1010809609 6:80285689-80285711 AATAATGCTTAGTTTACCCATGG - Intronic
1014578567 6:123105856-123105878 TTTGATGCTTAGTTTACTGAGGG + Intergenic
1032484927 7:132278478-132278500 GTAGGCGCTTAGTTGACCCTTGG - Intronic
1032746748 7:134793733-134793755 GTGGATGCTTATTCTATCCATGG + Intronic
1038387063 8:27158533-27158555 TTACATACTTAGTTTAACCATGG - Intergenic
1039096663 8:33894276-33894298 GTAGATGCTGAGTAAACGCAAGG - Intergenic
1047883085 8:129218169-129218191 GTGGATGTTTAGTTTTTCCATGG - Intergenic
1048948486 8:139472969-139472991 TGAGACTCTTAGTTTACCCAGGG - Intergenic
1052380405 9:27764866-27764888 GCAGATGCTTAGTATAGCAAAGG + Intergenic
1059892055 9:118814600-118814622 GGAGCTGCTTAGTTTACAAATGG - Intergenic
1060616916 9:125025132-125025154 GTTGTTTCTTAGTTTACACAGGG - Intronic
1060645223 9:125272971-125272993 GAAGCAGCTTAGTTTATCCAGGG + Intronic
1186416641 X:9389216-9389238 ATTGATGTTTAGTTTACCTATGG + Intergenic
1186855124 X:13618941-13618963 GTAGATGCTTAGTTTACCCAAGG + Intronic
1189066108 X:37810838-37810860 GGAGATGCTTTGTTTACTCAGGG - Exonic
1193658456 X:84226334-84226356 GTAGATGGTAAGTGTACACATGG - Intergenic
1196656404 X:118222483-118222505 GTAAATGCAAAGTTTAACCAAGG - Intergenic