ID: 1186857458

View in Genome Browser
Species Human (GRCh38)
Location X:13639891-13639913
Sequence CTGTGTGGCAGAGGAGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186857458_1186857464 18 Left 1186857458 X:13639891-13639913 CCCTCCACTCCTCTGCCACACAG No data
Right 1186857464 X:13639932-13639954 AGCCAAGTAGTGAGAATCCCTGG No data
1186857458_1186857465 19 Left 1186857458 X:13639891-13639913 CCCTCCACTCCTCTGCCACACAG No data
Right 1186857465 X:13639933-13639955 GCCAAGTAGTGAGAATCCCTGGG No data
1186857458_1186857462 -10 Left 1186857458 X:13639891-13639913 CCCTCCACTCCTCTGCCACACAG No data
Right 1186857462 X:13639904-13639926 TGCCACACAGCAGAGTACAGTGG No data
1186857458_1186857467 20 Left 1186857458 X:13639891-13639913 CCCTCCACTCCTCTGCCACACAG No data
Right 1186857467 X:13639934-13639956 CCAAGTAGTGAGAATCCCTGGGG No data
1186857458_1186857468 23 Left 1186857458 X:13639891-13639913 CCCTCCACTCCTCTGCCACACAG No data
Right 1186857468 X:13639937-13639959 AGTAGTGAGAATCCCTGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186857458 Original CRISPR CTGTGTGGCAGAGGAGTGGA GGG (reversed) Intergenic
No off target data available for this crispr