ID: 1186857460

View in Genome Browser
Species Human (GRCh38)
Location X:13639895-13639917
Sequence TCTGCTGTGTGGCAGAGGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186857460_1186857468 19 Left 1186857460 X:13639895-13639917 CCACTCCTCTGCCACACAGCAGA No data
Right 1186857468 X:13639937-13639959 AGTAGTGAGAATCCCTGGGGAGG No data
1186857460_1186857465 15 Left 1186857460 X:13639895-13639917 CCACTCCTCTGCCACACAGCAGA No data
Right 1186857465 X:13639933-13639955 GCCAAGTAGTGAGAATCCCTGGG No data
1186857460_1186857467 16 Left 1186857460 X:13639895-13639917 CCACTCCTCTGCCACACAGCAGA No data
Right 1186857467 X:13639934-13639956 CCAAGTAGTGAGAATCCCTGGGG No data
1186857460_1186857464 14 Left 1186857460 X:13639895-13639917 CCACTCCTCTGCCACACAGCAGA No data
Right 1186857464 X:13639932-13639954 AGCCAAGTAGTGAGAATCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186857460 Original CRISPR TCTGCTGTGTGGCAGAGGAG TGG (reversed) Intergenic
No off target data available for this crispr