ID: 1186857462

View in Genome Browser
Species Human (GRCh38)
Location X:13639904-13639926
Sequence TGCCACACAGCAGAGTACAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186857457_1186857462 -7 Left 1186857457 X:13639888-13639910 CCTCCCTCCACTCCTCTGCCACA No data
Right 1186857462 X:13639904-13639926 TGCCACACAGCAGAGTACAGTGG No data
1186857456_1186857462 8 Left 1186857456 X:13639873-13639895 CCAACAAGACAGTGGCCTCCCTC No data
Right 1186857462 X:13639904-13639926 TGCCACACAGCAGAGTACAGTGG No data
1186857458_1186857462 -10 Left 1186857458 X:13639891-13639913 CCCTCCACTCCTCTGCCACACAG No data
Right 1186857462 X:13639904-13639926 TGCCACACAGCAGAGTACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186857462 Original CRISPR TGCCACACAGCAGAGTACAG TGG Intergenic
No off target data available for this crispr