ID: 1186857464

View in Genome Browser
Species Human (GRCh38)
Location X:13639932-13639954
Sequence AGCCAAGTAGTGAGAATCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186857457_1186857464 21 Left 1186857457 X:13639888-13639910 CCTCCCTCCACTCCTCTGCCACA No data
Right 1186857464 X:13639932-13639954 AGCCAAGTAGTGAGAATCCCTGG No data
1186857458_1186857464 18 Left 1186857458 X:13639891-13639913 CCCTCCACTCCTCTGCCACACAG No data
Right 1186857464 X:13639932-13639954 AGCCAAGTAGTGAGAATCCCTGG No data
1186857463_1186857464 3 Left 1186857463 X:13639906-13639928 CCACACAGCAGAGTACAGTGGTT No data
Right 1186857464 X:13639932-13639954 AGCCAAGTAGTGAGAATCCCTGG No data
1186857461_1186857464 9 Left 1186857461 X:13639900-13639922 CCTCTGCCACACAGCAGAGTACA No data
Right 1186857464 X:13639932-13639954 AGCCAAGTAGTGAGAATCCCTGG No data
1186857459_1186857464 17 Left 1186857459 X:13639892-13639914 CCTCCACTCCTCTGCCACACAGC No data
Right 1186857464 X:13639932-13639954 AGCCAAGTAGTGAGAATCCCTGG No data
1186857460_1186857464 14 Left 1186857460 X:13639895-13639917 CCACTCCTCTGCCACACAGCAGA No data
Right 1186857464 X:13639932-13639954 AGCCAAGTAGTGAGAATCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186857464 Original CRISPR AGCCAAGTAGTGAGAATCCC TGG Intergenic
No off target data available for this crispr