ID: 1186857467

View in Genome Browser
Species Human (GRCh38)
Location X:13639934-13639956
Sequence CCAAGTAGTGAGAATCCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186857463_1186857467 5 Left 1186857463 X:13639906-13639928 CCACACAGCAGAGTACAGTGGTT No data
Right 1186857467 X:13639934-13639956 CCAAGTAGTGAGAATCCCTGGGG No data
1186857457_1186857467 23 Left 1186857457 X:13639888-13639910 CCTCCCTCCACTCCTCTGCCACA No data
Right 1186857467 X:13639934-13639956 CCAAGTAGTGAGAATCCCTGGGG No data
1186857459_1186857467 19 Left 1186857459 X:13639892-13639914 CCTCCACTCCTCTGCCACACAGC No data
Right 1186857467 X:13639934-13639956 CCAAGTAGTGAGAATCCCTGGGG No data
1186857460_1186857467 16 Left 1186857460 X:13639895-13639917 CCACTCCTCTGCCACACAGCAGA No data
Right 1186857467 X:13639934-13639956 CCAAGTAGTGAGAATCCCTGGGG No data
1186857458_1186857467 20 Left 1186857458 X:13639891-13639913 CCCTCCACTCCTCTGCCACACAG No data
Right 1186857467 X:13639934-13639956 CCAAGTAGTGAGAATCCCTGGGG No data
1186857461_1186857467 11 Left 1186857461 X:13639900-13639922 CCTCTGCCACACAGCAGAGTACA No data
Right 1186857467 X:13639934-13639956 CCAAGTAGTGAGAATCCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186857467 Original CRISPR CCAAGTAGTGAGAATCCCTG GGG Intergenic
No off target data available for this crispr