ID: 1186858818

View in Genome Browser
Species Human (GRCh38)
Location X:13651592-13651614
Sequence AGATGTCACCTGGAGGTTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186858818_1186858828 19 Left 1186858818 X:13651592-13651614 CCACCAACCTCCAGGTGACATCT No data
Right 1186858828 X:13651634-13651656 CAGCAAGAATCTTGTCAGGTTGG No data
1186858818_1186858827 15 Left 1186858818 X:13651592-13651614 CCACCAACCTCCAGGTGACATCT No data
Right 1186858827 X:13651630-13651652 TCTTCAGCAAGAATCTTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186858818 Original CRISPR AGATGTCACCTGGAGGTTGG TGG (reversed) Intergenic
No off target data available for this crispr