ID: 1186863320

View in Genome Browser
Species Human (GRCh38)
Location X:13694664-13694686
Sequence TGAGGTGCCCCAAAGCATCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 125}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186863320_1186863324 0 Left 1186863320 X:13694664-13694686 CCGTGATGCTTTGGGGCACCTCA 0: 1
1: 0
2: 0
3: 11
4: 125
Right 1186863324 X:13694687-13694709 GCATGCAGTTTGGGAACCTCAGG 0: 1
1: 0
2: 1
3: 9
4: 189
1186863320_1186863321 -10 Left 1186863320 X:13694664-13694686 CCGTGATGCTTTGGGGCACCTCA 0: 1
1: 0
2: 0
3: 11
4: 125
Right 1186863321 X:13694677-13694699 GGGCACCTCAGCATGCAGTTTGG 0: 1
1: 0
2: 2
3: 15
4: 125
1186863320_1186863325 12 Left 1186863320 X:13694664-13694686 CCGTGATGCTTTGGGGCACCTCA 0: 1
1: 0
2: 0
3: 11
4: 125
Right 1186863325 X:13694699-13694721 GGAACCTCAGGATTAGAAGTTGG 0: 1
1: 0
2: 0
3: 16
4: 139
1186863320_1186863322 -9 Left 1186863320 X:13694664-13694686 CCGTGATGCTTTGGGGCACCTCA 0: 1
1: 0
2: 0
3: 11
4: 125
Right 1186863322 X:13694678-13694700 GGCACCTCAGCATGCAGTTTGGG 0: 1
1: 0
2: 4
3: 16
4: 124
1186863320_1186863327 21 Left 1186863320 X:13694664-13694686 CCGTGATGCTTTGGGGCACCTCA 0: 1
1: 0
2: 0
3: 11
4: 125
Right 1186863327 X:13694708-13694730 GGATTAGAAGTTGGTATTATTGG 0: 1
1: 0
2: 1
3: 14
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186863320 Original CRISPR TGAGGTGCCCCAAAGCATCA CGG (reversed) Intronic
900902455 1:5526417-5526439 TGAGGGGCCTCAGAGCCTCAGGG + Intergenic
901919888 1:12528361-12528383 TGAGATGCCCCACAGTTTCATGG - Intergenic
902090989 1:13903035-13903057 TGGGAAACCCCAAAGCATCAGGG + Intergenic
903277759 1:22232743-22232765 TGAGGTCCCCCAAGGCCCCAGGG + Intergenic
904979153 1:34482225-34482247 TGAGGTTCCTCAAAGTTTCAAGG - Intergenic
908288910 1:62641418-62641440 TGAGGTGGTCCAAAGCAGCCTGG + Intronic
908815365 1:68026674-68026696 TGTGGTGCTCCAAAGTGTCAAGG - Intergenic
908954256 1:69601869-69601891 TCAGCTGTCCCAAAGCAGCAGGG - Intronic
912392061 1:109310028-109310050 GGAGGTGGGCCAAATCATCAGGG + Exonic
912502904 1:110134029-110134051 AGAGGGGCCCCATAGTATCATGG + Intergenic
915348564 1:155210725-155210747 GCAGGTGACCCAGAGCATCAAGG + Intronic
915351748 1:155231319-155231341 GCAGGTGACCCAGAGCATCAAGG + Intergenic
915963121 1:160283556-160283578 TCTGGGGCCCCGAAGCATCAGGG + Exonic
921439557 1:215168781-215168803 AGAGGTGCAGCAAACCATCATGG + Intronic
921720266 1:218463505-218463527 TGTGGTGCCCAGAAGCATAAAGG - Intergenic
924639915 1:245824103-245824125 TGGGGTGTCTGAAAGCATCAGGG + Intronic
1066321846 10:34310570-34310592 TGAGGAGGCACAAAGCATGACGG - Intronic
1067456705 10:46424328-46424350 TGAGGCTACCCAAAGCTTCATGG + Intergenic
1067630496 10:47960311-47960333 TGAGGCTACCCAAAGCTTCATGG - Intergenic
1070116786 10:73536395-73536417 TGTGGTGACCAAATGCATCAAGG - Exonic
1078185883 11:9051833-9051855 TGGGGTGGCCCAAATCACCAAGG + Intronic
1078775309 11:14388556-14388578 TGAGGTCACCCAAAGCAAGAAGG + Intergenic
1081266876 11:41035287-41035309 AGAGGTGCAGCAAACCATCATGG - Intronic
1081456979 11:43233349-43233371 TGAGGTGGCTCACAGAATCAAGG + Intergenic
1084962192 11:72722721-72722743 TGAGGTGCCTCCAGGCATCCAGG + Intronic
1090913208 11:131140106-131140128 AGAGGTGCTCCAGAGCATCATGG + Intergenic
1097388649 12:58981681-58981703 ATAGGTGCAGCAAAGCATCATGG + Intergenic
1098399164 12:70054732-70054754 GGAAATGCCCCAAAACATCAGGG - Intergenic
1099445030 12:82742114-82742136 GGAGAAGCCCCAAAGCATTAGGG - Intronic
1104436090 12:128757762-128757784 TGAGTTGCTACAAAGCCTCAGGG - Intergenic
1108176406 13:47797246-47797268 TTAAATGCCCCAAAGCAACATGG + Intergenic
1111566797 13:90027622-90027644 TGAGGTGGCACAAAGCAGCAAGG - Intergenic
1114304277 14:21407023-21407045 TGAGGCGTCCCTAAGCATGAAGG + Exonic
1116826315 14:49676804-49676826 TCAGGTGCCTTAAAGCCTCAGGG - Intronic
1118566416 14:67145970-67145992 TAAGCAGCACCAAAGCATCAGGG + Intronic
1119604943 14:76007454-76007476 TCAGGTTTCCTAAAGCATCAAGG + Intronic
1120008663 14:79388554-79388576 TTATGTGCCACAAAGCACCATGG - Intronic
1127327652 15:57911423-57911445 TGAGGTGACCCAACTCACCAGGG - Intergenic
1129359555 15:75016192-75016214 TGAAGGGCCCCAAAGCCTCAGGG - Intronic
1130150379 15:81307165-81307187 TGAGGAACACCAAAGAATCAGGG - Intronic
1131682004 15:94733395-94733417 TTAGGTGCGGCAAACCATCATGG - Intergenic
1137327951 16:47460877-47460899 TGAGGTCCCCGAAAGCCGCAAGG + Exonic
1138939634 16:61774687-61774709 TTAGGAGCCCCAAAGCACTATGG + Intronic
1140939553 16:79708482-79708504 TGAGGGCAACCAAAGCATCACGG - Intergenic
1141651500 16:85395460-85395482 TGAGGTGCCCCTTTGCATCTCGG - Intergenic
1141802898 16:86323180-86323202 GGAGGTGCCCTAAAGCAAGAAGG + Intergenic
1142558701 17:797009-797031 GGAAGTGTCCCAAAGCACCAAGG + Intergenic
1154017286 18:10630298-10630320 TGAGCTGACCCAAAACATCCGGG + Intergenic
1154187574 18:12199299-12199321 TGAGCTGACCCAAAACATCCGGG - Intergenic
1159762320 18:72443597-72443619 TGAGGTGCAGCAAACCACCATGG + Intergenic
1160179776 18:76624209-76624231 TGATGGGCCCCACAGCAGCAGGG + Intergenic
1161336151 19:3714716-3714738 TGAGGTCCCCCAGTGGATCAGGG - Intronic
1161725302 19:5925107-5925129 GGAGGGGCCCCACAGCATGAGGG + Intronic
1163021227 19:14481944-14481966 TGAGTTTCTCCAAGGCATCACGG + Intronic
1166595631 19:44046880-44046902 TGAGGTGCAGCAAACCACCATGG + Intergenic
1167433395 19:49465625-49465647 TGGGGTGCCCCAGAGGCTCACGG + Intronic
928647494 2:33369949-33369971 AGAGGAGCCCCAGGGCATCAGGG + Intronic
929451595 2:42041799-42041821 AGATTTGCCCCAAACCATCAGGG - Intergenic
931218731 2:60270032-60270054 TGAGATGCACCAATGCAACAGGG + Intergenic
931643280 2:64399911-64399933 TGAGGAGCCCCACAGCCTCCAGG + Intergenic
931810602 2:65851045-65851067 TGATGTGCTGCAAAGCATCTAGG - Intergenic
933701036 2:85255666-85255688 GGAGGGGCCCGAAAGGATCAGGG - Intronic
935388880 2:102529835-102529857 TGAAGTCCCCCAAACCAGCATGG - Intronic
936118415 2:109721065-109721087 TGAGCTGCCCCAAAACAAGATGG + Intergenic
937309181 2:120891650-120891672 AGAGGTGCCCATAAGCATCCAGG - Intronic
937760184 2:125591260-125591282 ATAGGTGCCCCAAACCACCATGG + Intergenic
943240773 2:185380582-185380604 ATAGGTGCCCCAAACCATCATGG + Intergenic
944891011 2:204117484-204117506 CGAGGTGCCCCAAGGGGTCACGG - Intergenic
946500098 2:220238152-220238174 GGTGGTGCCTCTAAGCATCATGG - Intergenic
948542997 2:238703318-238703340 TGAGGTGGCCCCAATCCTCAAGG + Intergenic
1168783296 20:513765-513787 TGATGAGCCCCAAAGCTTCAAGG - Intronic
1169200425 20:3706587-3706609 GGAGGTGCCCGACGGCATCACGG - Exonic
1169823797 20:9743685-9743707 TGTTGTTCCACAAAGCATCATGG - Intronic
1173618610 20:44419412-44419434 TGATAGGCACCAAAGCATCAAGG - Intronic
1176521099 21:7825093-7825115 ACAGGTGCCGCAAACCATCATGG + Intronic
1178655119 21:34455105-34455127 ACAGGTGCCGCAAACCATCATGG + Intergenic
1179468560 21:41595157-41595179 TTAGGTGCAACAAAGCACCATGG + Intergenic
1180180470 21:46116599-46116621 CTCGGTGCCTCAAAGCATCATGG - Intronic
1180518497 22:16171609-16171631 TGAGGTGGCACAAAGCAGCAAGG - Intergenic
1181550942 22:23638874-23638896 TGAGGAGCCCCAAGCCAACAAGG - Intergenic
1183753171 22:39733957-39733979 ATAGGTGCAGCAAAGCATCATGG - Intergenic
1183792355 22:40082922-40082944 TTGGGTGCCCCAAAGCATCTCGG - Intronic
1184036338 22:41920010-41920032 TGAGGGACCCCCAAGCCTCAAGG - Intergenic
1185056338 22:48580557-48580579 TGAGGTTTCCCAGAGCAGCAAGG + Intronic
950573651 3:13817659-13817681 TGAGGTGACCCAAAGCAGATGGG - Exonic
951946833 3:28147527-28147549 TGAGGTGCCTCAGAGAATAAAGG - Intergenic
954506058 3:51074753-51074775 TGAGGTGCAGCAAACCACCATGG + Intronic
961435036 3:126911145-126911167 TCAGGTGCCCCACAGCACCTGGG + Intronic
962236690 3:133712997-133713019 TAAGGTGCCCTAAATCATCTGGG - Intergenic
965494602 3:169382415-169382437 TGAGGACCCCCAAGGCAGCACGG + Intronic
967312786 3:188121868-188121890 TGCGGTTCCCCAAAGCATACAGG + Intergenic
968321450 3:197772448-197772470 TTAGGTGCCGCAAACCACCATGG + Intronic
971220130 4:24697716-24697738 TGAGGTGCCCCTGAGCTTCCTGG - Intergenic
972094718 4:35334374-35334396 TGAGGCTCCACAGAGCATCAGGG + Intergenic
973164820 4:47063961-47063983 TGAGGTGCAGCAAACCACCATGG + Intronic
974718336 4:65700968-65700990 TGAGGTGCCCCAAGGAAAAATGG + Intergenic
978377424 4:108089874-108089896 TGAGGAGGGCCAAAGCATAATGG - Intronic
981235551 4:142411299-142411321 TGAGATGTCCCAAAGGGTCAGGG + Intronic
985410566 4:189679462-189679484 CTAGGTGCCGCAAAGCCTCAGGG - Intergenic
986340977 5:6788945-6788967 TGAGGTGCTCCAAAAAATCACGG + Intergenic
986646216 5:9918752-9918774 TGAGGTGGGCCAAAACTTCAGGG + Intergenic
990116027 5:52392482-52392504 TATGGTGACCAAAAGCATCATGG + Intergenic
1004495224 6:16156583-16156605 TTGGGTGCCCCAAAGCTTTATGG - Intergenic
1007282358 6:40721922-40721944 TGAGGTGCCCCAAAGGGAGATGG - Intergenic
1011664550 6:89622008-89622030 TGAGGTGGCCCAAAGCAAGGTGG + Exonic
1011722209 6:90169077-90169099 TGTGGTGCCCCAGAGCATCTTGG + Intronic
1011878288 6:91990375-91990397 TGACATGTCCCAAAGCATCATGG - Intergenic
1013604856 6:111738421-111738443 TCAGGTGCCCCCAAGGCTCATGG + Intronic
1013745587 6:113342072-113342094 TGAGAAGCAGCAAAGCATCATGG - Intergenic
1019982178 7:4629711-4629733 TGAGCTCCCCAAAATCATCAAGG - Intergenic
1021056034 7:16047511-16047533 TGAGGTGACCATAAGAATCAAGG + Intergenic
1023158343 7:37274060-37274082 GGAGGTGACCCAGTGCATCAGGG - Intronic
1023372599 7:39527097-39527119 TGAGGTGCAGCAAACCACCATGG + Intergenic
1028312586 7:89357477-89357499 TCAGGAGCCCCAAATAATCACGG + Intergenic
1034542677 7:151768994-151769016 TGAGATGCTCCAAAGCTCCATGG + Intronic
1038715343 8:29986388-29986410 TGAGGCGCCCCATAGGATCTTGG + Intergenic
1040110372 8:43564556-43564578 TGGGGTGCCCCCATGCACCATGG + Intergenic
1044851415 8:96432495-96432517 TGAGATGACACAAAGCAGCAAGG - Intergenic
1050713194 9:8489485-8489507 GGAAGTGCCACAAAGCATAAAGG + Intronic
1052376939 9:27728363-27728385 TGAGGGGCCCCCTGGCATCATGG - Intergenic
1057163813 9:92910709-92910731 AGAGGTGCCCAATAGCAACAAGG - Intergenic
1061355728 9:130103473-130103495 TGAGATGCCACAGAGCATAAGGG - Intronic
1203672197 Un_KI270755v1:25964-25986 CTAGGTGCCGCAAAGCCTCAGGG + Intergenic
1186642191 X:11467547-11467569 TGAAATGCCACAAAGCAACAAGG + Intronic
1186863320 X:13694664-13694686 TGAGGTGCCCCAAAGCATCACGG - Intronic
1186989482 X:15052022-15052044 TGAGGTGCTCCAAATAATCCAGG - Intergenic
1188193035 X:27195900-27195922 ATAGGTGCAACAAAGCATCATGG + Intergenic
1188349073 X:29104808-29104830 TGATGTGCCACTAAGCATTAAGG + Intronic
1188778057 X:34246694-34246716 TGGGGTGGCCCACAGAATCAAGG + Intergenic
1189247093 X:39571696-39571718 TGATGTGCCCCAGAGACTCAGGG - Intergenic
1189553122 X:42113739-42113761 TGAGGTTGCACAGAGCATCAGGG + Intergenic
1192952604 X:76033296-76033318 TAAGGTGCAGCAAAGCACCATGG - Intergenic
1194539429 X:95152939-95152961 TTTGGTTCCCCAAAGCACCAGGG + Intergenic
1195961453 X:110391344-110391366 TGTGGTGCCCCCAAGCATGATGG - Intronic
1196600946 X:117601320-117601342 TGAGGTGCAGCAAACCACCATGG - Intergenic
1200013624 X:153140771-153140793 TGAGCTTCCTCAAAGCATAATGG + Intergenic
1200025977 X:153259147-153259169 TGAGCTTCCTCAAAGCATAATGG - Intergenic