ID: 1186865870

View in Genome Browser
Species Human (GRCh38)
Location X:13720339-13720361
Sequence TAGCAGCACGGACACCTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 50}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186865862_1186865870 29 Left 1186865862 X:13720287-13720309 CCCTAAGTGTCTGGTAGAGTAAG 0: 1
1: 0
2: 2
3: 10
4: 108
Right 1186865870 X:13720339-13720361 TAGCAGCACGGACACCTAGAAGG 0: 1
1: 0
2: 0
3: 0
4: 50
1186865863_1186865870 28 Left 1186865863 X:13720288-13720310 CCTAAGTGTCTGGTAGAGTAAGC 0: 1
1: 0
2: 7
3: 7
4: 107
Right 1186865870 X:13720339-13720361 TAGCAGCACGGACACCTAGAAGG 0: 1
1: 0
2: 0
3: 0
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186865870 Original CRISPR TAGCAGCACGGACACCTAGA AGG Intronic
903016356 1:20364685-20364707 GAGCAGCAGGGAACCCTAGATGG + Intergenic
924123504 1:240826568-240826590 AAGCAACACGTACAACTAGAAGG - Intronic
1073266167 10:102229869-102229891 TAGCAGAGCTGACACCTACAAGG + Intergenic
1076735061 10:132455272-132455294 CAGCAGCACAGAGACCCAGATGG + Intergenic
1084434529 11:69131209-69131231 TAGATGCACAGACACCCAGAGGG - Intergenic
1085346327 11:75770339-75770361 GAGCAGCACCCACACCAAGAGGG - Intronic
1093899629 12:24616333-24616355 GAGCAGCTCGCTCACCTAGAGGG + Intergenic
1102744375 12:115237553-115237575 TAGAAGCAAGGAGACCTGGAAGG + Intergenic
1116594215 14:46819490-46819512 TAGGCTCACGGACACATAGAAGG - Intergenic
1117408634 14:55429399-55429421 GAGCAGCACAGTTACCTAGAGGG - Intronic
1120969608 14:90196388-90196410 TAGGCTCACGGACACATAGAAGG - Intergenic
1129082874 15:73055998-73056020 TAGCAGGACAGACTTCTAGAGGG - Intronic
1130417990 15:83712450-83712472 TAGCAGTAGGGACTCCAAGAAGG - Intronic
1148533813 17:48421010-48421032 TAGCAGCAGGGAAGCCTGGAGGG + Intronic
1150839166 17:68591926-68591948 TAGGTTCACGGACACATAGAAGG - Intronic
1152899586 17:82932651-82932673 CAGCGGCACGGACACCCTGAGGG - Exonic
1153413657 18:4822128-4822150 AAGTAGCAAGGAAACCTAGAGGG - Intergenic
1153448136 18:5196715-5196737 CAGCAGCACCGGCACCTACACGG - Intronic
1154173768 18:12068403-12068425 GAGCAGCACGTACGCCAAGAGGG - Intergenic
1155527892 18:26735821-26735843 TAGGAGCAGGGACAATTAGAAGG - Intergenic
1159356992 18:67349299-67349321 TAGGCTCAGGGACACCTAGAAGG + Intergenic
1161914166 19:7216477-7216499 TAGCAGGACAGACATCCAGAGGG + Intronic
1164268128 19:23640935-23640957 TAGAAGTACGGACATCTATATGG + Intronic
1165665939 19:37628228-37628250 TGGCAGCAGGAACACCTACATGG - Intronic
926137409 2:10346518-10346540 TGCCTGCACGGAGACCTAGAGGG - Intronic
933061826 2:77747590-77747612 TAGACTCACGGACACATAGAAGG - Intergenic
937278033 2:120698605-120698627 TCCCAGCACGGCCACCTTGAGGG - Intergenic
948491996 2:238319887-238319909 AAGAATCACGGACACCTAGTAGG + Intergenic
1185235384 22:49709438-49709460 TAGCAGCAAGGACAGCTCCAGGG - Intergenic
949271513 3:2223254-2223276 TACCACCACGGACACCCACAGGG - Intronic
951814466 3:26738409-26738431 TAGCAGCAGGGACACTGAGGAGG + Intergenic
961785694 3:129345259-129345281 GAGCAGGAGGGACACCCAGAAGG - Intergenic
964987497 3:162762724-162762746 TAGCAGTAAGGACAACCAGAGGG + Intergenic
968111895 3:196055256-196055278 TACCACCATGGACACCTATAAGG - Exonic
978333452 4:107641000-107641022 TGGCAGCAAGGAGCCCTAGAAGG + Intronic
989152592 5:38315099-38315121 TACCAGCTAGGACACCAAGAAGG + Intronic
1010792241 6:80078101-80078123 TGGCAGCACTGCCTCCTAGATGG - Intergenic
1025235797 7:57234176-57234198 TAGCTGCAGGGACACAGAGATGG - Intergenic
1032795302 7:135271477-135271499 GAGCAGGACGGAAACCTGGAGGG + Intergenic
1036645509 8:10609529-10609551 CAGTAACACGGACACCCAGATGG + Exonic
1038370294 8:26982117-26982139 TAGGCTCACGGACACATAGAAGG - Intergenic
1046886019 8:119368022-119368044 TAGGCTCACGGACACATAGAAGG - Intergenic
1055357306 9:75450714-75450736 TTGGAGCAGGCACACCTAGAGGG - Intergenic
1057230321 9:93317770-93317792 TGGCAGCACGGGCACCTGGGGGG - Intronic
1057964068 9:99486347-99486369 TAGCAGTAGGAACATCTAGATGG + Intergenic
1058556792 9:106177332-106177354 TAGAAGCAGGGACAGCCAGAGGG - Intergenic
1058805183 9:108583596-108583618 TAGCAGCAGTAACACCTGGATGG - Intergenic
1061670873 9:132187483-132187505 TAGCAGCACAGAGAGCAAGAGGG + Intronic
1062107319 9:134762834-134762856 AAGAAGCACTGACATCTAGAAGG - Intronic
1186865870 X:13720339-13720361 TAGCAGCACGGACACCTAGAAGG + Intronic
1188434946 X:30148971-30148993 TAGGAGCACAGACAACTGGAGGG - Intergenic