ID: 1186866686

View in Genome Browser
Species Human (GRCh38)
Location X:13727181-13727203
Sequence CAATATCAGATCAACAAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 1, 2: 4, 3: 11, 4: 140}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186866681_1186866686 17 Left 1186866681 X:13727141-13727163 CCCACACAATAATAATGGGAGAC 0: 3588
1: 5382
2: 2493
3: 1239
4: 1047
Right 1186866686 X:13727181-13727203 CAATATCAGATCAACAAGACAGG 0: 1
1: 1
2: 4
3: 11
4: 140
1186866682_1186866686 16 Left 1186866682 X:13727142-13727164 CCACACAATAATAATGGGAGACT 0: 3585
1: 5527
2: 2752
3: 1484
4: 1003
Right 1186866686 X:13727181-13727203 CAATATCAGATCAACAAGACAGG 0: 1
1: 1
2: 4
3: 11
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186866686 Original CRISPR CAATATCAGATCAACAAGAC AGG Intronic
901209879 1:7518758-7518780 CAATGTCAGAACAAAAAGTCAGG + Intronic
902228264 1:15010688-15010710 CAATATCACAAAAGCAAGACGGG - Intronic
904590850 1:31614650-31614672 CAGGATTAGATCAACAAGGCTGG + Intergenic
907017832 1:51034492-51034514 CAAAATCAGATGTAAAAGACAGG - Intergenic
910222127 1:84898374-84898396 CAATATCAGCTCCACCAGCCTGG + Intergenic
912423220 1:109562180-109562202 CAATGGCAGATCAAAAATACTGG + Intronic
917520396 1:175743443-175743465 CAAAATAAGATCAAAAAGTCAGG + Exonic
919276582 1:195425122-195425144 TAATACCAGATCATCAGGACTGG + Intergenic
920447045 1:206025422-206025444 CAGTGAAAGATCAACAAGACGGG - Intergenic
923651457 1:235877936-235877958 AAATATAATATCAAGAAGACAGG + Intronic
923664670 1:235989569-235989591 AAATATCAGCACCACAAGACAGG - Intronic
1062871838 10:911460-911482 AAAAATCATACCAACAAGACAGG - Intronic
1063710645 10:8474476-8474498 CAATATCAGTGCAACAATGCAGG - Intergenic
1066018407 10:31271566-31271588 CAATGTCAGATCACAAACACTGG - Intergenic
1066363690 10:34755827-34755849 TAATGACAAATCAACAAGACAGG + Intronic
1067313348 10:45136733-45136755 CATTAGCAGCTCAAAAAGACAGG - Intergenic
1070343406 10:75519267-75519289 CAATATTAGATCAACGAGACAGG - Intronic
1074223492 10:111461150-111461172 CACTATCACATCAACAATGCAGG - Intergenic
1074651098 10:115525309-115525331 CATAATTAGATCAACAAGATTGG - Intronic
1083927742 11:65818675-65818697 CACTCTCAGAACAACATGACTGG - Intergenic
1087053216 11:93906612-93906634 TAATGTCAGATAAACAAGGCAGG + Intergenic
1087337462 11:96862789-96862811 GAATCTCAGAGCATCAAGACTGG - Intergenic
1088034460 11:105295349-105295371 CAATATTAGATCAATGAGACAGG - Intergenic
1089171067 11:116511912-116511934 CTGTATCAGATGAGCAAGACTGG + Intergenic
1092570605 12:9717112-9717134 GAAAATTAGTTCAACAAGACTGG + Intronic
1093590049 12:20891767-20891789 CAATTTCAGAGCTAGAAGACAGG - Intronic
1094054891 12:26258717-26258739 CAGTATTAGATCAATGAGACAGG + Intronic
1097650392 12:62291295-62291317 CAATCTCAGAACATAAAGACAGG - Intronic
1098008961 12:66030119-66030141 TAATATCAGATTCAAAAGACAGG - Intergenic
1099300422 12:80887676-80887698 CAATATCAGAGTGACAAGACTGG - Intronic
1108293554 13:48988226-48988248 CAGTATTAGATCAACGAGACAGG + Intronic
1111783817 13:92763001-92763023 CAATATCAGAAAAACAATCCAGG - Intronic
1113540345 13:111102316-111102338 GAATTTCAGATCTAAAAGACTGG + Intergenic
1115759393 14:36563066-36563088 CATTTTAAGATCAACAAGAGGGG + Intergenic
1122451621 14:101813212-101813234 CAATATCCTAGCCACAAGACAGG - Intronic
1126239719 15:46427487-46427509 CAACATTAGATCAATGAGACAGG + Intergenic
1127317599 15:57812691-57812713 CAATATTAGATCAACCATACAGG - Intergenic
1127653571 15:61033771-61033793 AAATATCTTATCAACAAGCCAGG + Intronic
1127758349 15:62114086-62114108 AACTATCAGATGAACAAGGCTGG - Intergenic
1129840549 15:78740750-78740772 AAGCATCAGATCAACATGACAGG + Intergenic
1130195491 15:81776887-81776909 TAATAACAGATGAACATGACTGG - Intergenic
1131902980 15:97108970-97108992 AAATATTAGATCAATAAGACAGG + Intergenic
1137561264 16:49503717-49503739 CACCATCAGCGCAACAAGACAGG + Intronic
1138534276 16:57651705-57651727 CAATATCAGATCATGAAGACTGG + Intronic
1139001747 16:62519216-62519238 CAATATTAGATCAACGAGACAGG + Intergenic
1140268253 16:73439335-73439357 CAAAATCAGATGAACAAAGCTGG - Intergenic
1145364008 17:22239007-22239029 GAATATCACATCAAAAACACTGG - Intergenic
1150624417 17:66832554-66832576 CAAAATCAGATCATCAAACCAGG + Intergenic
1150927165 17:69544999-69545021 CAAAATCTGATAAACAAGGCAGG - Intergenic
1153203752 18:2673984-2674006 CAAAATAAGTTCAAAAAGACAGG - Intronic
1153358020 18:4159584-4159606 AGATATCAGATGAACAACACAGG - Intronic
1155107313 18:22680333-22680355 CACTATCAGATCACCAGGCCAGG + Intergenic
1157066288 18:44354756-44354778 CAATATTAGATCAACGAGACAGG - Intergenic
1158017108 18:52797259-52797281 CAATAACAGATCCCCAAAACAGG - Intronic
1159497151 18:69221460-69221482 CTATAGCACATCAACAAGACAGG + Intergenic
1160147073 18:76374249-76374271 TACTATCAGATCATCTAGACTGG + Intronic
1167051437 19:47081391-47081413 CAATTCCAGATCAACCAAACTGG + Intronic
925283041 2:2698192-2698214 CAGTATCATATCCACAAAACTGG - Intergenic
927784825 2:25966404-25966426 CAATATAAGAGCAGCTAGACAGG - Intronic
929352058 2:40968383-40968405 AAATATCAGATGAATAAAACAGG - Intergenic
930280783 2:49367434-49367456 TAAAATCAGAACAAGAAGACAGG + Intergenic
930707325 2:54517585-54517607 CAAAATCAGATCATCCTGACAGG - Intronic
931163750 2:59722909-59722931 CAAAGTCAGATCATGAAGACCGG + Intergenic
935390730 2:102550039-102550061 CATTCTCAGATAAACAAAACTGG + Intergenic
936848746 2:116870869-116870891 CAATATTAGAACAATGAGACAGG - Intergenic
937276723 2:120689525-120689547 CAATATCAGCTCAACAAATATGG + Intergenic
937442468 2:121928540-121928562 CAATATAACATGAACAAAACAGG + Intergenic
939465044 2:142545858-142545880 CACTATCAGAGCTTCAAGACTGG - Intergenic
941127316 2:161600114-161600136 CAATTTCATATCCACAACACTGG - Intronic
943018724 2:182546728-182546750 CAATACCAGAGGAACAAGTCTGG + Intergenic
946507495 2:220317424-220317446 CAAAATCAGTCCAACAACACAGG - Intergenic
946821979 2:223639898-223639920 CCAAATCAGGTCACCAAGACTGG + Intergenic
946986146 2:225275711-225275733 CAATATCAGACCAAGAGGAATGG + Intergenic
948187606 2:236033974-236033996 CATTATGAGATCAACTCGACAGG - Intronic
948311475 2:236990118-236990140 CAACAACAAATCACCAAGACTGG + Intergenic
1170516264 20:17133478-17133500 CTATATAAGTTCCACAAGACAGG + Intergenic
1170710737 20:18788157-18788179 CACTATCACAAGAACAAGACAGG + Intergenic
1171066137 20:22017489-22017511 GAAGATCAGATAAGCAAGACTGG + Intergenic
1173130570 20:40389081-40389103 CATTTTCAGATCTACAAAACTGG + Intergenic
1177035666 21:16039429-16039451 CACTATCACAAGAACAAGACAGG + Intergenic
1178492282 21:33060333-33060355 CAATATCAGGTTACCAAGAAAGG - Intergenic
1184420041 22:44374500-44374522 CAATATCAGTTCAAAAACACAGG + Intergenic
950948190 3:16972548-16972570 CAATGTTAGATCATCAAGGCAGG - Intronic
952226666 3:31383601-31383623 GAAAATCAGATCCTCAAGACAGG - Intergenic
954723057 3:52582270-52582292 CAATATTATATGACCAAGACAGG - Intronic
954916951 3:54156560-54156582 CAATATAAGAACATGAAGACCGG - Intronic
957861689 3:85960156-85960178 CAATATCAAAACAAGAAGATTGG - Intronic
959842626 3:110995976-110995998 CTATATAAGACCAACATGACAGG + Intergenic
960187405 3:114660697-114660719 CATAATCAGCACAACAAGACAGG + Intronic
965356468 3:167680330-167680352 TAAAATTAGATCAACAAGAATGG + Intergenic
967131940 3:186478607-186478629 TAAGATCATATCAACAAGAAGGG - Intergenic
974304092 4:60108792-60108814 TAATACCATATCAATAAGACTGG - Intergenic
975426019 4:74228786-74228808 CTATATAAAATAAACAAGACAGG + Intronic
977332663 4:95657267-95657289 CAGTATTAGATCATCAAGGCAGG - Intergenic
980508322 4:133752729-133752751 CAATATCAGATACAAAAGAAGGG - Intergenic
980526952 4:134001860-134001882 TAAAAACAGATCAAGAAGACAGG + Intergenic
983313912 4:166101775-166101797 CAATAACAGATCGACAACAAAGG - Exonic
984492539 4:180453479-180453501 TAATGTCAGATCAACAATATTGG + Intergenic
985507700 5:293312-293334 GAAGAGCAGATCAAGAAGACGGG + Intronic
985507709 5:293402-293424 GAAGAGCAGATCAAGAAGACGGG + Intronic
985507719 5:293492-293514 GAAGAGCAGATCAAGAAGACGGG + Intronic
985507729 5:293582-293604 GAAGAGCAGATCAAGAAGACGGG + Intronic
985507739 5:293672-293694 GAAGAGCAGATCAAGAAGACGGG + Intronic
985507749 5:293762-293784 GAAGAGCAGATCAAGAAGACGGG + Intronic
985507759 5:293852-293874 GAAGAGCAGATCAAGAAGACGGG + Intronic
985507769 5:293942-293964 GAAGAGCAGATCAAGAAGACGGG + Intronic
985740264 5:1611727-1611749 GAAGAGCAGATCAAGAAGACGGG - Intergenic
985740274 5:1611817-1611839 GAAGAGCAGATCAAGAAGACAGG - Intergenic
985740283 5:1611907-1611929 GAAGAGCAGATCAAGAAGACGGG - Intergenic
986892088 5:12321035-12321057 CAATAACAGATCAAGATGGCTGG - Intergenic
988043380 5:25916413-25916435 CAATCTCAGATCCTGAAGACTGG + Intergenic
989830051 5:45905123-45905145 CAATATCTGATTAATAAGACAGG + Intergenic
990202172 5:53388386-53388408 CAATATCAGAACCAAAAGAGAGG + Intergenic
995049254 5:107683914-107683936 CAATCTTAGAGCAAGAAGACAGG + Intergenic
995907192 5:117139612-117139634 CAATTTTATATCAACAATACAGG - Intergenic
996776643 5:127139884-127139906 CAATATCTGATGAAAAACACTGG - Intergenic
997314294 5:132919290-132919312 CAAAGTCAAATCATCAAGACAGG + Intronic
1003782975 6:9449955-9449977 TAAAATCAGATCAATAAGAACGG + Intergenic
1004091070 6:12502413-12502435 GATTATCATATCAAAAAGACAGG + Intergenic
1004579419 6:16934327-16934349 CAATCTCAGAGAAACAAGAGAGG - Intergenic
1004593475 6:17076013-17076035 CAATATTAGATCAATGAGACAGG + Intergenic
1005739883 6:28781150-28781172 CAATGACAAATCAACAATACTGG - Intergenic
1006281403 6:33056765-33056787 CAATGTTGGATCAAAAAGACTGG - Intergenic
1008907034 6:56689829-56689851 CAATATCAACTTAACAAAACTGG + Intronic
1009733225 6:67636994-67637016 CAAAACCAGATCATCAAGATTGG + Intergenic
1012489894 6:99770717-99770739 CAATGTCTCATCATCAAGACAGG - Intergenic
1013382730 6:109593102-109593124 CAATCTCAGAGCTGCAAGACAGG - Intronic
1019841610 7:3451673-3451695 CAATATTTGATTAACAATACAGG + Intronic
1020475155 7:8585545-8585567 CAATGTAAGAGCAGCAAGACTGG - Intronic
1021477911 7:21083683-21083705 CAATATCAAATCTACAAGAGAGG + Intergenic
1024497958 7:50069748-50069770 CACTCTCAGATCCACCAGACGGG + Intronic
1032516555 7:132510378-132510400 CAATATCAGAGGAGGAAGACTGG + Intronic
1037451432 8:19019573-19019595 CAATAACAAATAAATAAGACTGG - Intronic
1042752090 8:72169458-72169480 CAATCTCAGAGCTAGAAGACTGG - Intergenic
1045070908 8:98503954-98503976 CAATATTAGATCAACAAGACAGG - Intronic
1048291037 8:133181887-133181909 TAATAACAGATAAACAAGAAAGG + Intergenic
1050156818 9:2676112-2676134 CACTATCAGAAGAACAACACAGG - Intergenic
1050173649 9:2847795-2847817 AAATATCAAATCAACAGGCCCGG - Intergenic
1051205325 9:14682614-14682636 CAACATTAGATCAACGAGACAGG + Intronic
1052210327 9:25895398-25895420 CAATATCAGCTGTATAAGACAGG + Intergenic
1052356217 9:27507357-27507379 CAATATGACAATAACAAGACTGG - Intronic
1052449302 9:28607067-28607089 CAATCTCAGAATACCAAGACAGG - Intronic
1052600970 9:30630047-30630069 CCTTATCAGATCAAGAACACCGG + Intergenic
1052733661 9:32318541-32318563 CAAAATCAGAGAAACAAGGCAGG - Intergenic
1056512748 9:87321202-87321224 CACTATCAGAAGAACAACACAGG - Intergenic
1056839318 9:89985874-89985896 CAATGTCAGTGCAACAAGAATGG - Intergenic
1056877372 9:90347508-90347530 CAACAGCAGATCAACATGAGAGG + Intergenic
1059615778 9:115949419-115949441 AAATTTCAGATCAACAAAAAAGG + Intergenic
1186443057 X:9602536-9602558 GAAAATCAGATCAACAACAGTGG + Intronic
1186866686 X:13727181-13727203 CAATATCAGATCAACAAGACAGG + Intronic
1194817371 X:98459966-98459988 CTACATCACATCAACTAGACAGG - Intergenic
1196600142 X:117592050-117592072 CAATATTAGATCATTGAGACAGG + Intergenic
1196810157 X:119622475-119622497 CAATTTCAGACCAACGAGTCAGG - Intronic
1196982521 X:121230963-121230985 CAATCTCAGATCTAGAAGATGGG - Intergenic
1199314909 X:146365549-146365571 CAATATCTCATAAGCAAGACTGG - Intergenic
1200756368 Y:6993763-6993785 GAAAATCAGATCAACAACAGTGG + Intronic
1201673028 Y:16546411-16546433 CAATGACAAATCAACAAAACAGG + Intergenic