ID: 1186870665

View in Genome Browser
Species Human (GRCh38)
Location X:13768191-13768213
Sequence ACTCCTGGTCTTGCTCCTGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 310
Summary {0: 1, 1: 0, 2: 0, 3: 40, 4: 269}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186870665_1186870677 23 Left 1186870665 X:13768191-13768213 CCAGCAGGAGCAAGACCAGGAGT 0: 1
1: 0
2: 0
3: 40
4: 269
Right 1186870677 X:13768237-13768259 TGGGCAGGGCAATCTGTGGGTGG 0: 1
1: 0
2: 4
3: 25
4: 307
1186870665_1186870669 3 Left 1186870665 X:13768191-13768213 CCAGCAGGAGCAAGACCAGGAGT 0: 1
1: 0
2: 0
3: 40
4: 269
Right 1186870669 X:13768217-13768239 CAGATAAGGTGCCAGTGCCATGG 0: 1
1: 0
2: 0
3: 15
4: 172
1186870665_1186870679 25 Left 1186870665 X:13768191-13768213 CCAGCAGGAGCAAGACCAGGAGT 0: 1
1: 0
2: 0
3: 40
4: 269
Right 1186870679 X:13768239-13768261 GGCAGGGCAATCTGTGGGTGGGG 0: 1
1: 0
2: 1
3: 25
4: 278
1186870665_1186870680 26 Left 1186870665 X:13768191-13768213 CCAGCAGGAGCAAGACCAGGAGT 0: 1
1: 0
2: 0
3: 40
4: 269
Right 1186870680 X:13768240-13768262 GCAGGGCAATCTGTGGGTGGGGG 0: 1
1: 0
2: 1
3: 24
4: 287
1186870665_1186870671 8 Left 1186870665 X:13768191-13768213 CCAGCAGGAGCAAGACCAGGAGT 0: 1
1: 0
2: 0
3: 40
4: 269
Right 1186870671 X:13768222-13768244 AAGGTGCCAGTGCCATGGGCAGG 0: 1
1: 0
2: 1
3: 19
4: 257
1186870665_1186870676 20 Left 1186870665 X:13768191-13768213 CCAGCAGGAGCAAGACCAGGAGT 0: 1
1: 0
2: 0
3: 40
4: 269
Right 1186870676 X:13768234-13768256 CCATGGGCAGGGCAATCTGTGGG 0: 1
1: 0
2: 3
3: 16
4: 157
1186870665_1186870678 24 Left 1186870665 X:13768191-13768213 CCAGCAGGAGCAAGACCAGGAGT 0: 1
1: 0
2: 0
3: 40
4: 269
Right 1186870678 X:13768238-13768260 GGGCAGGGCAATCTGTGGGTGGG 0: 1
1: 0
2: 1
3: 13
4: 258
1186870665_1186870672 9 Left 1186870665 X:13768191-13768213 CCAGCAGGAGCAAGACCAGGAGT 0: 1
1: 0
2: 0
3: 40
4: 269
Right 1186870672 X:13768223-13768245 AGGTGCCAGTGCCATGGGCAGGG 0: 1
1: 0
2: 3
3: 31
4: 359
1186870665_1186870670 4 Left 1186870665 X:13768191-13768213 CCAGCAGGAGCAAGACCAGGAGT 0: 1
1: 0
2: 0
3: 40
4: 269
Right 1186870670 X:13768218-13768240 AGATAAGGTGCCAGTGCCATGGG 0: 1
1: 0
2: 0
3: 6
4: 121
1186870665_1186870674 19 Left 1186870665 X:13768191-13768213 CCAGCAGGAGCAAGACCAGGAGT 0: 1
1: 0
2: 0
3: 40
4: 269
Right 1186870674 X:13768233-13768255 GCCATGGGCAGGGCAATCTGTGG 0: 1
1: 0
2: 0
3: 20
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186870665 Original CRISPR ACTCCTGGTCTTGCTCCTGC TGG (reversed) Exonic
901034363 1:6327386-6327408 CCTCCTCCTCCTGCTCCTGCCGG + Exonic
902506863 1:16944214-16944236 CCTCCTGCTCTTCCTCCAGCCGG - Exonic
902637348 1:17743327-17743349 GCTCCTGCTCCTGCTCCTGCTGG + Intergenic
902999879 1:20257628-20257650 ACTCCAGGGCTTTCTCCTTCTGG + Intergenic
903559807 1:24218762-24218784 GCACCTGGCCCTGCTCCTGCTGG + Intergenic
905934578 1:41813306-41813328 GCGCCTAGTGTTGCTCCTGCTGG - Intronic
908796241 1:67833427-67833449 CCTCCTCCTCTTGCTCCTCCGGG + Exonic
909349183 1:74629606-74629628 TCTCCTGGTCATTTTCCTGCTGG + Intronic
913387596 1:118276717-118276739 ACTACTGGTGGTGCCCCTGCTGG - Intergenic
914779369 1:150770982-150771004 GCTGCTGCTCCTGCTCCTGCTGG - Intergenic
914957839 1:152180615-152180637 CCACCTTGTCCTGCTCCTGCAGG + Intergenic
917260381 1:173160582-173160604 ACTCCTGGTCTTGTTTTTGTTGG - Intergenic
919974503 1:202602042-202602064 GCTCCTGGTATGGCACCTGCAGG + Exonic
922401208 1:225258335-225258357 ACTTCTGGAATTTCTCCTGCAGG - Intronic
924245817 1:242083424-242083446 AAACATGGTTTTGCTCCTGCAGG + Exonic
1063223229 10:3990574-3990596 GCACCTGGCCTTCCTCCTGCAGG - Intergenic
1063759451 10:9056785-9056807 GCTCCTGGGCTGGCGCCTGCTGG + Intergenic
1065253309 10:23838907-23838929 TCTGCTGTTCTTGCACCTGCAGG + Intronic
1065814763 10:29473687-29473709 AGTCCTGGTCTGGCTTCTGCAGG - Intronic
1067425237 10:46204777-46204799 CCTCCTGGTCATGCTCCCACTGG - Intergenic
1067667174 10:48288521-48288543 CCTCCTGCTCTTCTTCCTGCAGG - Intergenic
1067680665 10:48436574-48436596 GCACCTGTTCTTGCTCCTGTTGG - Exonic
1067943318 10:50674812-50674834 CCTCCTGGTCATGCTCCCACTGG - Intergenic
1069062928 10:63913106-63913128 TCTCCTGGTGCTGCTACTGCTGG - Intergenic
1070643819 10:78187628-78187650 AATGGTGGTCTTTCTCCTGCAGG + Intergenic
1070656929 10:78278084-78278106 ACTGCTGGCGTTTCTCCTGCTGG + Intergenic
1070864655 10:79700591-79700613 CCTCCTGGTCATGCTCCCACTGG - Intergenic
1070878444 10:79838721-79838743 CCTCCTGGTCATGCTCCCACTGG - Intergenic
1071631557 10:87222820-87222842 CCTCCTGGTCATGCTCCCACTGG - Intergenic
1071645000 10:87355032-87355054 CCTCCTGGTCATGCTCCCACTGG - Intergenic
1072961414 10:99932800-99932822 AAATCTGGTCTTGCTCGTGCAGG + Intronic
1072964914 10:99963561-99963583 AAATCTGGTCTTGCTCGTGCAGG - Intronic
1073429388 10:103476488-103476510 CCCCCTGGTCTGGATCCTGCTGG - Exonic
1074071280 10:110072398-110072420 ACCCCTGGTCTAGGTCCTGAGGG + Intronic
1075102881 10:119518482-119518504 TCTCCTGATCGTGCACCTGCAGG - Intronic
1075379760 10:122009541-122009563 TCTTCTGTTCTTGCTCTTGCTGG + Intronic
1075507290 10:123035582-123035604 GCGCCTGGACTTGCTCCAGCTGG - Intronic
1076335276 10:129702647-129702669 TCTCCTGCACTGGCTCCTGCTGG + Intronic
1077200634 11:1305767-1305789 ACTCCTTGTCCTGCTTCTGGAGG - Intronic
1077407952 11:2391062-2391084 ACTCCTGCTCCTGCTCCTGGGGG - Intronic
1078104849 11:8351980-8352002 CCTGCTGGTATTTCTCCTGCTGG - Intergenic
1078721071 11:13883575-13883597 AGTCCTTCTCTTGCTCCTTCTGG - Intergenic
1079009009 11:16813127-16813149 ACTCCAGGTCTTTCTTCAGCTGG + Exonic
1080787371 11:35487730-35487752 AGTCCTAGTCTGCCTCCTGCTGG - Intronic
1081253255 11:40861536-40861558 ACTCCTGATCTTACTCCTTCGGG - Intronic
1082796335 11:57380672-57380694 GCTCCTGCCCTTTCTCCTGCTGG - Exonic
1084441336 11:69175477-69175499 GTTCCTGCTCTTTCTCCTGCTGG - Intergenic
1084470813 11:69357904-69357926 CCTCCTGGGCTTGCTTCTGGAGG - Intronic
1089560347 11:119340367-119340389 ACTCCTCGTCCTGCTGCTCCTGG - Exonic
1089646727 11:119885301-119885323 GCTCCTTCTCTTGCTCCTCCAGG + Intergenic
1089676236 11:120091853-120091875 TTTCCTGGTCTTGAGCCTGCTGG + Intergenic
1090274228 11:125408468-125408490 CCTCCTGGTGTGGCTCCTCCGGG - Intronic
1091516838 12:1192743-1192765 ACTGCTGCTTTTGCTACTGCTGG + Intronic
1091549553 12:1527614-1527636 ACTCCTGGTCATGCCCTCGCAGG - Intergenic
1091709315 12:2726585-2726607 CCTCCTGTGCTTTCTCCTGCAGG - Intergenic
1091804130 12:3343804-3343826 ACAACTGGACTTGCTCCTTCAGG + Intergenic
1092245245 12:6860440-6860462 ACTCCTGGGCATCCTGCTGCCGG - Exonic
1092858734 12:12700006-12700028 TCTCCTCATGTTGCTCCTGCTGG + Intergenic
1093182180 12:15979292-15979314 ACTGCTGGTGCTGCTCCTACTGG + Intronic
1096259087 12:50079906-50079928 ACTCCTGGTCCTTCTCCACCAGG - Exonic
1098496199 12:71138194-71138216 GCTTCTGATCCTGCTCCTGCAGG - Exonic
1098650706 12:72963754-72963776 ACTGCTGATCTAGCTCATGCAGG + Intergenic
1098980765 12:76953196-76953218 ACTCCTGGTCTTTGTCATGCTGG + Intergenic
1102992913 12:117327710-117327732 ACTTTTGGTCTTCCTCCTCCTGG + Intronic
1105329808 13:19405149-19405171 ACTCCTGGGCTTGATCTTGCTGG - Intergenic
1105329888 13:19405796-19405818 ACTCCTGGACTTGGTCTTGCTGG - Intergenic
1107032900 13:35871270-35871292 GCTCTTGGTGGTGCTCCTGCGGG + Exonic
1108673079 13:52711387-52711409 ATTCCTGCTCTTGCTCCTATGGG - Intronic
1109876092 13:68405915-68405937 ACACCTGGTGTTGGGCCTGCAGG - Intergenic
1110095721 13:71517711-71517733 ACTTCTGGTTGTGCTCATGCAGG - Intronic
1111468434 13:88646457-88646479 CCCCTTGTTCTTGCTCCTGCTGG + Intergenic
1112251108 13:97781512-97781534 TTTTTTGGTCTTGCTCCTGCAGG + Intergenic
1113679707 13:112234706-112234728 GGTCCTGGTCCTGCTCCTGGGGG + Intergenic
1114057407 14:18984244-18984266 GCTCCCGCTCTTGCTGCTGCCGG + Intronic
1114105139 14:19417503-19417525 GCTCCCGCTCTTGCTGCTGCCGG - Intronic
1114570257 14:23661867-23661889 ACGTCTGGTCTGGCCCCTGCTGG + Intergenic
1114874461 14:26698400-26698422 ATTTCTAGTCTTCCTCCTGCTGG - Intergenic
1119407722 14:74409277-74409299 TCTCCTTGTGTTGCTCATGCTGG + Intronic
1119661333 14:76454153-76454175 CCTCTTGGTCTTTCTCCTCCTGG - Intronic
1119877237 14:78071260-78071282 ACTCTTGCTCCTGCTGCTGCTGG + Intergenic
1120942737 14:89964306-89964328 GCTCCTGCTCTTCCTCCTGCAGG - Intronic
1121087091 14:91154972-91154994 CCTCCCTGCCTTGCTCCTGCTGG + Intronic
1122089862 14:99330943-99330965 GCTCCTGGTCTCGGTCCTGAGGG - Intergenic
1122503885 14:102219470-102219492 ACTCCAGGGCTTGTGCCTGCAGG + Intronic
1122771268 14:104098986-104099008 GCACCTGGCCCTGCTCCTGCGGG - Intronic
1122774276 14:104110345-104110367 ACCCCTGGTCTTGCTTTTGAAGG + Intronic
1123021533 14:105399962-105399984 TCTCCTGGTCTCTCTACTGCTGG + Intronic
1124925143 15:34063523-34063545 CCTCCTGGTCATCCTCCCGCAGG + Exonic
1125165201 15:36695815-36695837 ACTCTTGGTCTTGCCCAGGCTGG - Intronic
1125723584 15:41856849-41856871 ACACCTGGTGCTGCTCCTGCAGG + Exonic
1127359418 15:58231867-58231889 AATCCTGGTCCTGGCCCTGCTGG - Intronic
1129192139 15:73943396-73943418 ACTCCTGGGCTCTATCCTGCAGG - Intronic
1129567762 15:76641677-76641699 CCTCCTTTTCTTGTTCCTGCTGG - Intronic
1130275226 15:82472816-82472838 GCTCCTGGGCTTCCTCCTGCCGG + Intergenic
1130467587 15:84200211-84200233 GCTCCTGGGCTTCCTCCTGCTGG + Intergenic
1130496678 15:84473331-84473353 GCTCCTGGGCTTCCTCCTGCTGG - Intergenic
1130537844 15:84799722-84799744 ACTCCTGGGCTGGCTAGTGCTGG - Intronic
1130589879 15:85204809-85204831 GCTCCTGGGCTTCCTCCTGCTGG + Intergenic
1132989713 16:2786508-2786530 TCTCCAGGTCCTGCTCCTTCTGG - Exonic
1135719781 16:24806262-24806284 CCTGCTGGTCTTGCTGCGGCCGG - Exonic
1136156106 16:28383316-28383338 GCTCCTGGTTGCGCTCCTGCAGG + Exonic
1136206980 16:28731972-28731994 GCTCCTGGTTGCGCTCCTGCAGG - Exonic
1136547089 16:30961248-30961270 ACTCCTGTTCTTTCCCCAGCTGG + Exonic
1139293066 16:65875283-65875305 TCACCTTGTCTTGTTCCTGCTGG - Intergenic
1139857091 16:69989982-69990004 GCTCCTCTTCTGGCTCCTGCTGG - Intergenic
1141612849 16:85192913-85192935 ACCCCTGTTCTTGGTTCTGCTGG + Intergenic
1141686986 16:85576072-85576094 ATTCCTGGCCTTGCTCCTGTGGG - Intergenic
1143012005 17:3871117-3871139 CCCCCTGGTCTCGCTGCTGCTGG - Intronic
1143140424 17:4739279-4739301 GCTCCTGCTTCTGCTCCTGCTGG - Exonic
1143537420 17:7549467-7549489 CCTCCTGGGCAGGCTCCTGCTGG - Exonic
1143646229 17:8232021-8232043 ACCTCTGGACTTGCTCCTGGGGG + Exonic
1144809353 17:17988839-17988861 CCTCCTGGATTTGGTCCTGCTGG - Intronic
1145351980 17:22091322-22091344 AAACCTTGTCTTCCTCCTGCTGG - Intergenic
1145722718 17:27088654-27088676 AAACCTTGTCTTCCTCCTGCTGG + Intergenic
1147550450 17:41438175-41438197 ACTCCTGGTTTTGCCGCTCCAGG + Exonic
1147900461 17:43780054-43780076 ACTTGTGGTCTTGCACCTTCAGG + Intergenic
1150069757 17:62140507-62140529 GGTCTTGGTCTTGCTCCTGGGGG + Intergenic
1151165812 17:72202843-72202865 ACTCCTGCTGCTGCTGCTGCTGG + Intergenic
1151290157 17:73144062-73144084 ACTTCTGGCCTAGCTCCTGCAGG + Intergenic
1151322490 17:73360219-73360241 GCTCCTGGGCTGCCTCCTGCAGG + Intronic
1151556904 17:74851307-74851329 TCTCCTGGTCCTGCCCCTGCAGG - Intronic
1152122308 17:78426354-78426376 CCTCCTGGCCATGCTCCTGCAGG + Intronic
1152218253 17:79046910-79046932 TCTCCTGCTCTTGGTCCTGTGGG - Intronic
1152686579 17:81696645-81696667 GCTCCTTCTCCTGCTCCTGCAGG - Exonic
1152735940 17:81996786-81996808 GCTCCTGCTCCTGCTCCTGCTGG - Exonic
1152735951 17:81996822-81996844 GCTCCCGCTCCTGCTCCTGCTGG - Exonic
1154007929 18:10549030-10549052 ACACCTGATCTTGGTCTTGCTGG - Exonic
1156404533 18:36771689-36771711 ACTCCTGGTCTTTCTGGTGTGGG + Intronic
1158564261 18:58541261-58541283 GCTCTTGGTCCTGCTCCTGTCGG - Intronic
1158891517 18:61876284-61876306 ACGCATGTTCTTACTCCTGCAGG + Intronic
1160094528 18:75859714-75859736 GCCCCTGGTCTGGCCCCTGCTGG + Intergenic
1160729154 19:632870-632892 GGTCTTGGTCTTGCTCCTGGGGG + Exonic
1160919120 19:1511743-1511765 ACTCCTGATCCAGCCCCTGCCGG - Intronic
1164450820 19:28362858-28362880 ACACTTGCTCTTTCTCCTGCTGG - Intergenic
1165717748 19:38057517-38057539 ACTCCTGGTGTTGCTCATTGAGG + Intronic
925024014 2:593852-593874 CCTCCTGCTCCTGCTCCTGTAGG - Intergenic
925284314 2:2705932-2705954 ACTCCTTCTCTGACTCCTGCAGG - Intergenic
925571735 2:5319460-5319482 TTTCCTGGGCTTGCTCCTGCTGG + Intergenic
926197573 2:10773021-10773043 ACTGCTGCTCTGGCCCCTGCAGG - Intronic
927908793 2:26881583-26881605 CCTCCTGTGCCTGCTCCTGCCGG - Intronic
928502162 2:31907761-31907783 AGACACGGTCTTGCTCCTGCTGG - Intronic
929575525 2:43049556-43049578 ACTCCCGGCCTTGATCCTGAAGG - Intergenic
930037918 2:47099406-47099428 CTTCCTAGTCCTGCTCCTGCCGG - Intronic
930742141 2:54842517-54842539 ACTCCTGCTCTAGGTCCAGCTGG - Intronic
930865403 2:56117908-56117930 ATTCCTGGTGCTGCTGCTGCTGG - Intergenic
934708675 2:96501797-96501819 CCTCCTGGTCCTGCTCTTTCTGG + Intronic
935339845 2:102049987-102050009 ACTCTGGGTCTTGCTTCTGAGGG + Intergenic
935623445 2:105148295-105148317 GCTCCTGGTGCTGCTGCTGCTGG - Intergenic
936057672 2:109273037-109273059 ACTACTGGTCTTTCTCCCACTGG - Intronic
937390654 2:121483031-121483053 CCTCCCTCTCTTGCTCCTGCTGG - Intronic
938672130 2:133596646-133596668 ACTCCTGAACCTGCTTCTGCTGG - Intergenic
940347476 2:152642601-152642623 GCTCCTGGTCTTGCTCAGGGTGG - Intronic
941227235 2:162865163-162865185 ACACATGGTGTTGGTCCTGCAGG - Intergenic
941479476 2:165988459-165988481 ACTCCTCCCCTTGCTCCTTCAGG - Intergenic
941506214 2:166348781-166348803 ACTCTTGGACTGGCTCCTGAGGG - Intronic
943739125 2:191391626-191391648 AGTCCAGTTCTTGCTCCCGCTGG + Intronic
946389070 2:219404761-219404783 TCTCCTGGTCTTCCAGCTGCTGG - Intergenic
946662327 2:222014864-222014886 CCTCCTCTTCTTGCTCCAGCAGG - Intergenic
947362736 2:229363080-229363102 AACCCTGGCTTTGCTCCTGCTGG + Intronic
947363610 2:229371421-229371443 ATTCCTGGTCATGCACCTGCTGG - Intronic
947631722 2:231657884-231657906 ACCCCTTGGCTTGCTCCTGATGG + Intergenic
947634872 2:231674887-231674909 ACTCCTGGCCTGGCTCCAGAAGG + Intergenic
947791578 2:232872053-232872075 AGGCCTGGTCTGGCCCCTGCGGG - Intronic
947843854 2:233228001-233228023 ACTCCAGGTCCTTCTCATGCTGG + Intronic
947887549 2:233585685-233585707 ACTCCTGGTCCAGATCCTCCAGG - Intergenic
947893670 2:233648081-233648103 ACTCCTGGTCCAGATCCTCCAGG - Intronic
948396808 2:237650612-237650634 GCTTCTGCTCTTGCCCCTGCTGG - Intronic
948752622 2:240141303-240141325 CCTCCTGGTCCTGCTCCTTGGGG + Intronic
948846946 2:240687742-240687764 ACTCCTGGCTTTTCGCCTGCAGG + Intergenic
948900772 2:240955954-240955976 TCACCTGCGCTTGCTCCTGCTGG - Intronic
1170821362 20:19758223-19758245 CCTCCTCCTCTTGCTCCTCCCGG + Intergenic
1171562315 20:26136606-26136628 AAACCTTGTCTTCCTCCTGCTGG - Intergenic
1172447057 20:34998772-34998794 CCTCCTCGTGTTGCTCCCGCAGG - Exonic
1172519654 20:35558545-35558567 ACCACTGCTCCTGCTCCTGCTGG - Intergenic
1172843890 20:37918218-37918240 CCTCCAAGCCTTGCTCCTGCTGG - Intronic
1172856633 20:38009356-38009378 ACTCCTTCTCTTGCTCCTCAAGG + Intronic
1172947426 20:38700304-38700326 ACCCTTGTTGTTGCTCCTGCTGG - Intergenic
1174975361 20:55327190-55327212 TCTGCTGCTCTTGCTGCTGCTGG + Intergenic
1176512896 21:7762044-7762066 ATTCCTGGTCCTTCTCCTGCAGG - Intronic
1176649013 21:9529046-9529068 AAACCTTGTCTTCCTCCTGCTGG + Intergenic
1178622882 21:34191993-34192015 ACTCCTGGTCCTGAGACTGCAGG - Intergenic
1178647009 21:34392568-34392590 ATTCCTGGTCCTTCTCCTGCAGG - Intronic
1179573393 21:42291650-42291672 CCTCCTGGGCTGGCACCTGCAGG - Exonic
1179596494 21:42446197-42446219 ACTCCTGGACTTTCTTATGCTGG + Intronic
1179923561 21:44520577-44520599 GCTCCTGGTCCGGCCCCTGCGGG + Intronic
1180475896 22:15706853-15706875 GCTCCCGCTCTTGCTGCTGCCGG + Intronic
1180565006 22:16656032-16656054 ACTCCTGGACTTGGTCTTGCTGG + Intergenic
1180565092 22:16656675-16656697 ACTCCTGGGCTTGATCTTGCTGG + Intergenic
1181050444 22:20235834-20235856 ACTCCAGGTCATTCTGCTGCCGG - Intergenic
1181056733 22:20263774-20263796 CCTCCTGGTCTGGCTGCTGTGGG + Intronic
1181275395 22:21684820-21684842 ACTCCTTGTAGAGCTCCTGCAGG - Exonic
1181413751 22:22745089-22745111 GCGCCTGGCCTGGCTCCTGCTGG - Intronic
1183639546 22:39084667-39084689 GCTCCTGGGCTTCATCCTGCGGG + Intronic
1184843326 22:47065489-47065511 ACTCCTGGACCTGCTTCTGTTGG + Intronic
1185383472 22:50521104-50521126 CATCATGCTCTTGCTCCTGCTGG + Intronic
949766819 3:7535900-7535922 ACCCCTGGACTTGTTCTTGCAGG - Intronic
950744242 3:15074194-15074216 ACTACTGGTCCTCCTGCTGCAGG - Exonic
950798616 3:15531506-15531528 ACTCCAGCTCCTGCTCCTGCTGG + Intergenic
950887847 3:16376368-16376390 ACTCCTGCCCTTTCTCCTGGGGG + Intronic
952955767 3:38556309-38556331 GGTCCTCTTCTTGCTCCTGCTGG - Intronic
953403041 3:42643344-42643366 GCTCCTGGATCTGCTCCTGCTGG - Exonic
953540730 3:43815455-43815477 ACTCCTGGCCTGCCTCCTGTTGG + Intergenic
953695152 3:45152488-45152510 ACCTCTGGCCTTGCTCCTTCTGG + Intergenic
953877783 3:46676285-46676307 CCTCCTGGGCCAGCTCCTGCAGG + Exonic
954740211 3:52743545-52743567 ACTTTTGGGCTAGCTCCTGCTGG - Intronic
955791424 3:62592390-62592412 ACTCCTGCTCTATCTCCTGTAGG + Intronic
956872681 3:73433665-73433687 ACTGCTCCTCTTGCTTCTGCAGG + Intronic
957944907 3:87051736-87051758 CCTGCTGCTCTTGCTCATGCAGG - Intergenic
958524651 3:95240532-95240554 ACTCCAGCTCCTGCACCTGCTGG - Intergenic
960340809 3:116472897-116472919 TCCTCTGGTCTTGCTCCAGCAGG - Intronic
961056693 3:123794613-123794635 ACTCCTGGTCCAGGGCCTGCTGG + Intronic
961471941 3:127120688-127120710 GCTTCTGCTCTTGTTCCTGCAGG + Intergenic
968047158 3:195630903-195630925 ACTCCTGGCCAGGCTCCTCCTGG - Intergenic
968047414 3:195631936-195631958 ACTCCTGGCCAGGCTCCTCCTGG + Intergenic
968307199 3:197657988-197658010 ACTCCTGGCCAGGCTCCTCCTGG - Intergenic
968307489 3:197659141-197659163 ACTCCTGGCCAGGCTCCTCCTGG + Intergenic
968876325 4:3269647-3269669 CCTCCTGCTCCTCCTCCTGCAGG + Intronic
969230506 4:5827068-5827090 TCACCTGGTCTAGCTCCTGCAGG + Intronic
969532812 4:7739265-7739287 TCCACTGGTCTTGCTCCTGCTGG + Intronic
969680833 4:8642497-8642519 ACTCCTGGTCCTTATCCTACTGG + Intergenic
970099361 4:12503167-12503189 ACACATGGTGTTGGTCCTGCGGG - Intergenic
972056520 4:34809241-34809263 ACACCTGGTCTTTATGCTGCTGG - Intergenic
972541577 4:40043702-40043724 CCTCCTCCTCCTGCTCCTGCCGG + Intergenic
979055446 4:115987488-115987510 ACTACTGGTTCTGTTCCTGCAGG - Intergenic
980450055 4:132958873-132958895 ACTCCCGGTCTTGCCCTCGCAGG + Intergenic
985744194 5:1637228-1637250 ACTCCTGGCCAGGCTCCTCCTGG - Intergenic
985744446 5:1638230-1638252 ACTCCTGGCCAGGCTCCTCCTGG + Intergenic
987361588 5:17111958-17111980 ACTCCTGTTCTTACTCCTTCTGG - Intronic
989184722 5:38612517-38612539 AAACCTGGTTTTGCTCCTGATGG + Intergenic
991435955 5:66596997-66597019 CCTCCTCGTCCTGCTCCTCCTGG - Exonic
992093993 5:73343306-73343328 AATCCTAATCTTGCTCCTGGAGG + Intergenic
993454351 5:88110441-88110463 GCTCCAGGTGTTGCTCCTGCTGG - Intergenic
995032966 5:107499926-107499948 ACCCATGGGCTTTCTCCTGCTGG - Intronic
996580702 5:125029259-125029281 GCTCCGGGTTTTGCCCCTGCTGG + Intergenic
998256777 5:140594349-140594371 GCTCCTGCTCTGCCTCCTGCAGG + Intergenic
1000390486 5:160718110-160718132 ATTCATGGTCTTGCCTCTGCAGG + Intronic
1000631879 5:163599899-163599921 ATTGCTGGTCAAGCTCCTGCAGG - Intergenic
1000637563 5:163661327-163661349 ACCCCTGGTGATGCTTCTGCAGG - Intergenic
1000700911 5:164448639-164448661 GAATCTGGTCTTGCTCCTGCAGG - Intergenic
1001847306 5:174933668-174933690 CCTGCTGGTCTTGCTGCTGCTGG + Intergenic
1002132530 5:177090409-177090431 GCTCCTGCTCTTGCTGCTCCAGG - Exonic
1002837399 6:876479-876501 ACTCCTGGAGATGTTCCTGCAGG - Intergenic
1006096795 6:31661157-31661179 CCCCCTTGTCTTGCTCATGCCGG - Intergenic
1006648161 6:35529465-35529487 ACTCCTGCTCTAGAGCCTGCTGG - Intergenic
1007478151 6:42132934-42132956 AGACCTGGCCTAGCTCCTGCTGG + Intronic
1007766996 6:44166542-44166564 CCTCCTGCTCTTGCTTCTGGGGG + Intronic
1008356997 6:50566430-50566452 AATACTCTTCTTGCTCCTGCTGG - Intergenic
1008913106 6:56757837-56757859 AGTCCTGGACTGCCTCCTGCTGG + Intronic
1013748132 6:113369316-113369338 ACTCATGTTCTTTCTCTTGCAGG - Intergenic
1014336705 6:120146831-120146853 CCTCCTGCTCCTGCTCCTGCAGG + Intergenic
1014859527 6:126447900-126447922 ACTTCTTGTGTTGCTCCTCCGGG + Intergenic
1015582477 6:134740907-134740929 TAGCCTGGTCTTGCTGCTGCCGG - Intergenic
1017822589 6:158060172-158060194 GCTCCTGGACCTGCTGCTGCTGG + Intronic
1020414538 7:7930813-7930835 ACTCCTGGTCCCACTCCTGAGGG - Intronic
1020857838 7:13451462-13451484 ACTCTTGGTCTTGTTACTGTTGG - Intergenic
1023150400 7:37196399-37196421 AAACGTGGCCTTGCTCCTGCTGG + Intronic
1024052627 7:45638184-45638206 ACTCCTCCTCTTCCTCCTTCGGG + Intronic
1024564447 7:50669838-50669860 ACTGCTGGTCTTCCTCCTGAAGG + Exonic
1024961494 7:54981440-54981462 CCTCCTGGGCTGGCTGCTGCAGG - Intergenic
1025275547 7:57579118-57579140 AAACCTTGTCTTCCTCCTGCTGG + Intergenic
1026601485 7:71781271-71781293 GCTCCTGGGCTTTCTCCAGCTGG + Exonic
1028910226 7:96199566-96199588 ACTCCTGCTCTTGGACCTTCTGG - Intronic
1028962838 7:96769139-96769161 ACTCCTGGACTTGCACCAGTAGG + Intergenic
1031051913 7:116953636-116953658 ATTCCTGGTCTACATCCTGCGGG + Exonic
1031679466 7:124653222-124653244 ACTCCTGTGCTTCCTGCTGCAGG - Intergenic
1032463958 7:132131908-132131930 ACTCCAGGCCTTGGGCCTGCTGG + Intronic
1033607840 7:142940428-142940450 ACGACTGGTCTTCTTCCTGCTGG - Exonic
1034273540 7:149814520-149814542 GCTCCTGGTCTGGCCCCTGCAGG - Intergenic
1035185876 7:157125550-157125572 ACTGCTGGGGATGCTCCTGCGGG - Intergenic
1036237831 8:7056709-7056731 ACTCCTGCTCTCCCTCCTGCAGG - Exonic
1036947917 8:13112256-13112278 AGTCCTGCTCCAGCTCCTGCGGG + Intronic
1039708828 8:40034988-40035010 ACTCCTGGTCTTACAATTGCAGG - Intergenic
1041773940 8:61503509-61503531 AATCCTTGTCTTTCTGCTGCAGG - Exonic
1045173648 8:99697253-99697275 GCTCCTTGTGGTGCTCCTGCTGG - Intronic
1049757215 8:144316051-144316073 TCTCCTGGTGCTACTCCTGCTGG - Exonic
1051481188 9:17563136-17563158 ACTCCTATTCTTGATCATGCAGG + Intergenic
1051812913 9:21070509-21070531 ACTCCTGGTTTTGCTCCAAGTGG - Intergenic
1053029210 9:34759709-34759731 AATCCTGCACCTGCTCCTGCCGG + Intergenic
1056439304 9:86604360-86604382 CCCCATGGTCTTGCTCCTGCTGG - Intergenic
1056661135 9:88544231-88544253 GCTCCTGCTCTCCCTCCTGCTGG - Intronic
1056763600 9:89431254-89431276 GCTCCTGCTCCTGCTCCTGCGGG + Intronic
1056767520 9:89454173-89454195 CCTCCTGGTCTTGCCCAGGCTGG - Intronic
1056796603 9:89662939-89662961 CCTCTTTGTCTTGCTTCTGCTGG + Intergenic
1056825264 9:89872683-89872705 ATGCATGGGCTTGCTCCTGCAGG - Intergenic
1057356105 9:94332646-94332668 CCTCCTGGTCATGCTTCCGCTGG + Intergenic
1057651646 9:96924982-96925004 CCTCCTGGTCATGCTTCCGCTGG - Intronic
1058976129 9:110127135-110127157 AGTCCTGTTCCTGCTCCTGCAGG - Intronic
1059285037 9:113165269-113165291 AGTCATCCTCTTGCTCCTGCAGG - Intronic
1059738026 9:117121831-117121853 ACTCCCTGTCTCTCTCCTGCTGG - Intronic
1062044288 9:134417947-134417969 TCTCCTGGGCTGGCTCCAGCTGG + Intronic
1062151511 9:135021590-135021612 ACTCCTGCTCCAGCCCCTGCAGG + Intergenic
1062171751 9:135138597-135138619 CCTCTTGGCCCTGCTCCTGCAGG + Intergenic
1062200480 9:135300252-135300274 GCTCCGGCTCTTGCTCCTTCTGG - Intergenic
1203626749 Un_KI270750v1:32595-32617 AAACCTTGTCTTCCTCCTGCTGG + Intergenic
1186248558 X:7641003-7641025 TTTCCTGGTCTTGGTTCTGCTGG - Intergenic
1186517291 X:10175362-10175384 ACTGCTGGTTCAGCTCCTGCTGG - Intronic
1186870665 X:13768191-13768213 ACTCCTGGTCTTGCTCCTGCTGG - Exonic
1187292844 X:17971990-17972012 AGTAGTGGTCTTTCTCCTGCTGG + Intergenic
1192434116 X:71132176-71132198 AGGCTTGGTCTTGCTGCTGCTGG - Exonic
1193463702 X:81820671-81820693 AATCCTAGTCTTGCTCCTCCTGG - Intergenic
1194206674 X:91018998-91019020 AATCCTGGTCTAGCCCCTTCTGG - Intergenic
1194560788 X:95417145-95417167 ACTCTAGGACTTGCACCTGCAGG + Intergenic
1195830296 X:109050258-109050280 ATTCATGGTCTTGCTACTGTAGG - Intergenic
1198410100 X:136358114-136358136 ACTCGTGGTCCAGCTCCTCCTGG + Intronic
1199084637 X:143614939-143614961 ACCCCAGGTCTTGCTTCTGTGGG + Intergenic
1200552421 Y:4593787-4593809 AATCCTGGTCTAGCCCCTTCTGG - Intergenic
1200836892 Y:7740772-7740794 GCTCCTGGTTTTCTTCCTGCTGG + Intergenic
1201609287 Y:15823075-15823097 ACTCCAGTTCTTGCTCATGAAGG - Intergenic
1202601393 Y:26597000-26597022 ACTCCTGGACTTGGTCTTGCTGG + Intergenic
1202601472 Y:26597622-26597644 ACTCCTGGGCTTGATCTTGCTGG + Intergenic