ID: 1186876061

View in Genome Browser
Species Human (GRCh38)
Location X:13819377-13819399
Sequence AGAACTTTTCTGGCCAAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 257}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186876061_1186876063 -8 Left 1186876061 X:13819377-13819399 CCATTTTTGGCCAGAAAAGTTCT 0: 1
1: 0
2: 2
3: 27
4: 257
Right 1186876063 X:13819392-13819414 AAAGTTCTATATGTAGAAGTAGG 0: 1
1: 0
2: 1
3: 24
4: 264
1186876061_1186876064 -4 Left 1186876061 X:13819377-13819399 CCATTTTTGGCCAGAAAAGTTCT 0: 1
1: 0
2: 2
3: 27
4: 257
Right 1186876064 X:13819396-13819418 TTCTATATGTAGAAGTAGGATGG 0: 1
1: 0
2: 1
3: 9
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186876061 Original CRISPR AGAACTTTTCTGGCCAAAAA TGG (reversed) Intronic
904157481 1:28496797-28496819 AGAACTTTGGTGGCCAGTAAGGG - Exonic
905872115 1:41410669-41410691 AGGAGTTTTCTGGGCAAAGAAGG + Intergenic
906255642 1:44347518-44347540 ATAATTTGTCTGGCAAAAAATGG - Intronic
906663348 1:47598240-47598262 TGTACTTTTCTGAACAAAAATGG - Intergenic
906754056 1:48292188-48292210 AGAACTTTTCTTACCAAAGGTGG - Intergenic
906806408 1:48783114-48783136 ATTACTTTTCTGGGCAAAATAGG - Intronic
906843443 1:49164446-49164468 AGAGCTTTTTTAGCCCAAAAAGG + Intronic
907352302 1:53842433-53842455 AGAACTTTTATAATCAAAAAAGG + Intergenic
908683220 1:66685386-66685408 AGTACTGTTCTGGCCAAAACAGG - Intronic
908683458 1:66688231-66688253 AGAACTTTTCTGAACAAGAACGG + Intronic
909036988 1:70604568-70604590 AGAAAATTTCTGGGAAAAAAAGG - Intergenic
910121545 1:83796113-83796135 AGAACATTTCTGGACAAAATAGG + Intergenic
914449456 1:147777846-147777868 AGACTTTTACTGGCTAAAAAGGG + Intergenic
914785917 1:150830570-150830592 AAAACTATGCTGGCCAAATATGG + Intronic
915231686 1:154450412-154450434 AGAACATTTCTGGCCAGGCACGG - Intronic
915245390 1:154552616-154552638 TGAACTTTTCAGGCCAAGAATGG - Intronic
916183804 1:162111725-162111747 AGAATATTTCTGGCCAAAAATGG + Intronic
916365731 1:164025368-164025390 AGAACTTTTCTGTCTTACAAGGG - Intergenic
916459852 1:165012205-165012227 TGAAATTTGCTGACCAAAAAAGG + Intergenic
916697681 1:167256175-167256197 ACAACTTATCTGGCCATCAACGG + Intronic
916699062 1:167272327-167272349 AGAACATTCCCAGCCAAAAAAGG - Intronic
917955112 1:180088177-180088199 ACAATTTTTATGGCCAAAAATGG + Intronic
918728199 1:187952880-187952902 AGAATTTTTCTGCCCAAACTAGG - Intergenic
920261441 1:204690742-204690764 AGAACCTGTATGGGCAAAAAGGG + Intergenic
922682825 1:227615110-227615132 AGACCTTTTCTCACAAAAAATGG - Intronic
923804177 1:237240198-237240220 ATAACTCTTCTGGCAAAAGAGGG - Intronic
924547384 1:245042426-245042448 AGAGCTATTCTGTTCAAAAAAGG - Intronic
924647659 1:245894100-245894122 AGAACTTTTCTGTCTTACAAGGG + Intronic
1063311814 10:4959713-4959735 AGAATTTTTTTTGCCAAATATGG + Intronic
1065082072 10:22138903-22138925 AGAACTTTTCTGTCTTACAAGGG + Intergenic
1065083048 10:22145947-22145969 AGAACTTTTCTGTCTTACAAGGG + Intergenic
1065883451 10:30058068-30058090 AGAAATGCTCTGGCAAAAAAAGG - Intronic
1069526108 10:69173586-69173608 AGAACTTTTCTGTCTTACAAGGG + Intergenic
1070331328 10:75419521-75419543 AGAACTGTTCTAGATAAAAATGG - Intergenic
1070933889 10:80278893-80278915 AGAACTTTGCTGGCCACTGAAGG + Intronic
1072946978 10:99819185-99819207 AGTGCTCTCCTGGCCAAAAAAGG + Exonic
1074054282 10:109908021-109908043 TGAACTTTTCTGGCCACAAATGG - Intronic
1074617312 10:115082089-115082111 GAAACTATTCTGGCTAAAAAGGG + Intergenic
1074895195 10:117771357-117771379 AAAGCTTCTCTGGCCTAAAAGGG - Intergenic
1075471708 10:122695870-122695892 AGAACTCTTGTTGCCGAAAAAGG - Intergenic
1076077752 10:127549265-127549287 CGAACTTTTCTGGTATAAAAGGG + Intergenic
1080063553 11:27983007-27983029 ATACCTTTTCTGGCCAGGAATGG - Intergenic
1081188831 11:40078881-40078903 AGCAGTTTTCTCCCCAAAAAAGG - Intergenic
1081509486 11:43755007-43755029 AGAAGCTTCCTGGCCACAAATGG - Intronic
1081905538 11:46667213-46667235 AAAAGTCCTCTGGCCAAAAACGG - Intronic
1082717409 11:56631271-56631293 AGAACTGTTCTTGCCTGAAATGG - Intergenic
1085905810 11:80761092-80761114 AGGAGCTTTCTGGTCAAAAAAGG - Intergenic
1086234760 11:84615795-84615817 AGAAAATTTCAGGACAAAAACGG + Intronic
1087224926 11:95588155-95588177 AGAACTTTTCTAGGCAAAGATGG + Intergenic
1087318544 11:96633240-96633262 ATAATATTTCTTGCCAAAAATGG - Intergenic
1088298305 11:108326138-108326160 ACAAGTATTCTGGGCAAAAAAGG + Exonic
1088369414 11:109073045-109073067 AGTTCTTTTCTGGCTTAAAAGGG + Intergenic
1090563794 11:127964385-127964407 AGAACTATTCTGGACAAATCTGG + Intergenic
1091096614 11:132828703-132828725 AGAATTTTTCTAGCCAACATCGG - Intronic
1093194670 12:16116043-16116065 AGAACTTTTCTGGCTACCCAAGG + Intergenic
1093513327 12:19954829-19954851 AGAACTTATCTGGGCAACAATGG - Intergenic
1095718776 12:45377389-45377411 ATAACGTATCTGGCCAAATAAGG - Intronic
1097322922 12:58245849-58245871 TGAGCTTTTCTGCCCAAGAAGGG + Intergenic
1097378308 12:58863877-58863899 AGTGCTATTCTGGCCATAAAGGG - Intergenic
1098488256 12:71046633-71046655 TGAACTTTTCTGGCCACCATGGG + Intergenic
1099065108 12:77966491-77966513 AGAACAGTTCTGGCAAAATATGG - Intronic
1099149685 12:79094955-79094977 AAAGCTTTGCTTGCCAAAAATGG + Intronic
1099752181 12:86789953-86789975 AGAAATTATCTGGCCCTAAAGGG + Intronic
1100548536 12:95625579-95625601 AGAAGTTTGCTGGCTAAAGAAGG + Intergenic
1101256105 12:102978308-102978330 AGAAGTTTTCTTTCCTAAAAGGG + Intergenic
1103025200 12:117568114-117568136 AGCACTTTTCTCTCCATAAAAGG + Intronic
1103893109 12:124254617-124254639 TGGACTTTTCAGGTCAAAAATGG - Intronic
1104600334 12:130149191-130149213 ACAACTTTCCTGGGCAAAAAAGG + Intergenic
1106732063 13:32551760-32551782 AGAACTTTTCTGGCTACTATGGG + Intergenic
1107884675 13:44865605-44865627 AGAGTTATTCTGGGCAAAAATGG - Intergenic
1109011556 13:56954365-56954387 AGAGATATTCTGCCCAAAAAAGG - Intergenic
1109136672 13:58660110-58660132 AGAAATTTTCTGGGCAAAGTTGG - Intergenic
1109956916 13:69580787-69580809 ATAACTTTTCAGGCCTAAAAAGG + Intergenic
1110707865 13:78615495-78615517 AGAACTTTTATGAGGAAAAAAGG + Exonic
1110722449 13:78779598-78779620 AGAGTATTACTGGCCAAAAAGGG - Intergenic
1110767069 13:79292629-79292651 AGAACTGTGCTGACCAAAACTGG - Intergenic
1111110154 13:83696951-83696973 AGAAATTTTCTGCCCAAACTGGG - Intergenic
1112004068 13:95238860-95238882 AGAACTTTTAAGACCACAAAGGG + Intronic
1112731835 13:102371428-102371450 AGAAGTTTGCTGGCTAAGAAGGG - Intronic
1112821105 13:103336822-103336844 AGGACTTTTCTTGCTAAAACTGG - Intergenic
1115306714 14:31941186-31941208 GGCACATTTCTGGCCAAAAGAGG - Intergenic
1115488507 14:33936340-33936362 TGAAGTTTTCTGGCCAGAAATGG + Intronic
1115764228 14:36606382-36606404 AGTACTGTTCTTGCCTAAAATGG - Intergenic
1116027297 14:39530722-39530744 ATATCTTTTCTGACCAAAATGGG - Intergenic
1116938477 14:50767104-50767126 AGAACTGTGCTGTCCAAAACAGG + Intronic
1116992168 14:51287989-51288011 AGAACTTTTATGCCAGAAAATGG + Intergenic
1117654104 14:57936845-57936867 AGAATTTTAATGGACAAAAAGGG + Intronic
1121482075 14:94286673-94286695 AGAGCTTCTCTGGCTAAAGACGG - Intronic
1121983576 14:98476853-98476875 AGAACTTATCTGTCATAAAAAGG + Intergenic
1124000370 15:25754378-25754400 AGAACTTTTGAGGCCAAAGCAGG - Intronic
1124642458 15:31404367-31404389 AGAACTTTTCTGTCTTACAAAGG + Intronic
1126272595 15:46838906-46838928 AGATCTTTAATGGCCAAACATGG + Intergenic
1127078932 15:55356613-55356635 ATAACTCTACTGGCAAAAAAGGG + Intronic
1127152849 15:56096006-56096028 ATTACTTTTCTGCCCCAAAAGGG + Exonic
1127162235 15:56201314-56201336 AGAACTTTTCTTATCACAAAAGG + Intronic
1129793863 15:78361277-78361299 AGACCTTTTCTGGGCAGACAAGG + Intergenic
1130165806 15:81456867-81456889 AGAACTTTTCTGTCTTACAAGGG + Intergenic
1131765035 15:95666535-95666557 CTATCTTTTCTGGCAAAAAAAGG + Intergenic
1132256121 15:100377957-100377979 AGAAATTTTCTGGCCAGGCACGG + Intergenic
1134398295 16:13885615-13885637 AAAACTTTCCTGGGCAAACAGGG + Intergenic
1135624132 16:23981072-23981094 ACAAATTTCCTGGCCTAAAATGG + Intronic
1136583024 16:31165692-31165714 GGAACTCTTCTGGCCCACAAAGG - Intergenic
1137389562 16:48070018-48070040 AGAAATTTTGTAACCAAAAATGG - Intergenic
1138564893 16:57825855-57825877 AAAACTTTTCTCTACAAAAATGG - Intronic
1139110326 16:63882663-63882685 AGCAGTTTTCTAGCCAAAGAGGG - Intergenic
1139774224 16:69304397-69304419 AGCACTTTTTAGGCCAAAGAAGG + Exonic
1140786127 16:78343838-78343860 AAAACTTTTCAAGCCCAAAACGG - Intronic
1142169987 16:88616721-88616743 AGAACTTTTCTCACCTAAACTGG + Intronic
1143838206 17:9709817-9709839 AATTCATTTCTGGCCAAAAATGG + Intronic
1145020147 17:19423796-19423818 AGAAATCTGCTGGCCTAAAATGG - Intergenic
1147898206 17:43766238-43766260 TGAATTTTTCTGGACAGAAAAGG - Exonic
1148356632 17:46979470-46979492 AGAGGTTTTCTAGCCAAGAACGG - Intronic
1150237334 17:63603723-63603745 AGGTCTTTTCTGGCCAGACATGG + Intronic
1152294847 17:79460990-79461012 AGAAGTTTTCTGGCAAGAACTGG - Intronic
1152413068 17:80139982-80140004 AGCACTTTTGTCGCTAAAAATGG - Intronic
1155344488 18:24845148-24845170 GGAACATATCTGGCCATAAAAGG - Intergenic
1155844175 18:30684819-30684841 AGATATTTTCAGGACAAAAAAGG - Intergenic
1156076627 18:33287022-33287044 AGAGGTTTTCTGGCTAACAAAGG + Intronic
1156098044 18:33560720-33560742 AGAATTTTACTGGGCAAAAAGGG + Intergenic
1156759943 18:40576669-40576691 AGAACTGTCCTGGCACAAAATGG - Intergenic
1156954342 18:42943377-42943399 AGAACTTTTCTGTCTTATAAGGG - Intronic
1157154843 18:45255388-45255410 TGGTCTTTTGTGGCCAAAAAGGG + Intronic
1159600152 18:70421326-70421348 AGAACTTTTCTGGCTAGGCATGG - Intergenic
1162602501 19:11679552-11679574 AGAAATTAGCTGGACAAAAAAGG + Intergenic
1165979551 19:39708338-39708360 ACAACTTTAATGCCCAAAAAAGG - Intronic
926213291 2:10887384-10887406 AAAGCCTTTCTGGCCAAACATGG - Intergenic
926598747 2:14818930-14818952 AGAAATTTTCTAGGTAAAAAAGG - Intergenic
926706430 2:15841008-15841030 AGAAGTTTTCTGGCACAGAACGG - Intergenic
927232279 2:20835451-20835473 AGAAACTTTCTGGGCCAAAAGGG - Intergenic
928048586 2:27965166-27965188 AGAAATTTTATCACCAAAAATGG - Intronic
928976737 2:37095081-37095103 AGAACTTTTATGGCAAAAGGAGG + Intronic
929407974 2:41665173-41665195 AGATCTTTTGTTGTCAAAAAGGG - Intergenic
929804394 2:45132104-45132126 AGAACTTTTCTGTCTTACAAAGG - Intergenic
931641480 2:64384252-64384274 AGAACTTTTTTGAGAAAAAAAGG + Intergenic
931972329 2:67602566-67602588 AGAACAATTTTTGCCAAAAATGG - Intergenic
934960102 2:98665475-98665497 AGAACTCTTCTTGCCTAAAATGG - Intronic
935110469 2:100089584-100089606 TGAATTTTTATGGCAAAAAAGGG - Intronic
936124506 2:109775617-109775639 TGAATTTTTATGGCAAAAAAGGG + Intergenic
936220183 2:110595839-110595861 TGAATTTTTATGGCAAAAAAGGG - Intergenic
936718993 2:115226405-115226427 GCAACTTTTCTGACCAAGAATGG - Intronic
940540920 2:155016171-155016193 AAAACCTTTTTGGCAAAAAAAGG + Intergenic
940931501 2:159437519-159437541 ATCACTTTTCTGGCCAGACATGG - Intronic
940981014 2:160004265-160004287 AGAACTGTTCTGGGCAAATGAGG + Intronic
941381486 2:164798469-164798491 ACAACTATTCAAGCCAAAAAAGG + Intronic
942382567 2:175407179-175407201 GGCACTTCTCTGGCCAACAAAGG + Intergenic
942890148 2:180979753-180979775 AGAACTTTTCTTTCCAGAACTGG + Intronic
943042362 2:182819119-182819141 AGAGGTTTTGTGGCCCAAAATGG + Intergenic
943897468 2:193383499-193383521 AGAACTTTTCTGTCTTACAAGGG + Intergenic
945474256 2:210263092-210263114 AGAACTTTTCTGGCCAGGCGTGG - Intergenic
945839157 2:214867749-214867771 GGAAATTTTCTGACAAAAAAGGG - Intergenic
945907612 2:215612949-215612971 AGAATTCTTCTGACCAACAACGG + Intergenic
946300734 2:218822622-218822644 AGGAGTTTTCTGGACAAGAATGG + Exonic
946498525 2:220220599-220220621 AGAAGATTTATGGACAAAAAAGG + Intergenic
947023169 2:225706235-225706257 AGCACTGTTCTGGGCATAAAAGG + Intergenic
947399667 2:229718442-229718464 AGAACTGTTCTGGCCAAAGTAGG - Intergenic
947877131 2:233474898-233474920 TGACTTTTTCTAGCCAAAAAAGG - Intergenic
1168995222 20:2128202-2128224 AGAACTGCTCTGGCAAAAGAGGG + Intronic
1169874920 20:10286515-10286537 AGAACATTTCTGCCCAACACAGG - Intronic
1170009068 20:11701033-11701055 AGTACTTTTATTGCCAGAAAGGG - Intergenic
1170423105 20:16211883-16211905 AGAACATTTCTCTTCAAAAAGGG + Intergenic
1170925868 20:20723154-20723176 GGAAAATTTCTGGCTAAAAATGG - Intergenic
1172928339 20:38561730-38561752 AGAACTTATCTGGCCCAAGATGG - Intronic
1174239798 20:49124349-49124371 AGAACTTTTCTGAACACAGAAGG - Intronic
1174443346 20:50573714-50573736 ATAACTGTTGTGGACAAAAATGG - Intronic
1174803955 20:53590935-53590957 TGAAGTTTTCCTGCCAAAAATGG + Intronic
1177321450 21:19526310-19526332 ATAACTTGTCTGGGCAGAAATGG - Intergenic
1178191274 21:30283791-30283813 AGAACTTATTTGGGGAAAAACGG - Intergenic
1179666312 21:42915100-42915122 ACAACTCTTCTTACCAAAAAAGG + Intergenic
1180359681 22:11877001-11877023 AGAATTTTTGTGTCCTAAAATGG + Intergenic
1183534937 22:38395292-38395314 TGAACTTTTCCTGCCAAAAATGG + Intronic
1183546539 22:38457094-38457116 AGGAATTCTCTGGGCAAAAAAGG - Intergenic
949449338 3:4167618-4167640 AGAACTTTTCTGTCTTACAAGGG - Intronic
951301863 3:21008293-21008315 AGAACTTTTCTGTCTTACAAGGG - Intergenic
951462631 3:22967970-22967992 AGAACTATGCTGTCCAAATATGG + Intergenic
953494990 3:43378254-43378276 AGAGCTTTTCTGGGCAGAGAAGG - Intronic
954194005 3:48985376-48985398 AGAATTTTTCTGCCCTACAAAGG + Exonic
955347161 3:58169746-58169768 GGAACTCTTCTGGCCCACAAAGG - Exonic
955883187 3:63569756-63569778 ACAGCTCCTCTGGCCAAAAATGG + Intronic
956810141 3:72856708-72856730 ACAATCTTTCTAGCCAAAAAAGG - Intronic
960131348 3:114059386-114059408 TGAACTTTCCTTGGCAAAAAAGG + Intronic
960752241 3:120967946-120967968 ATAACTTTTCTGACCATAATGGG - Intronic
961002306 3:123382192-123382214 AGGACTTTTCTGGCATTAAAAGG - Intronic
962813338 3:138977396-138977418 AGAACTTCTAAGGCCAAGAAAGG + Intergenic
965354889 3:167661750-167661772 AGACATTTTCTAGCCAGAAATGG + Intergenic
966095320 3:176193629-176193651 AGATCTTTCTTAGCCAAAAATGG - Intergenic
967139283 3:186540446-186540468 AGAGCTTTTCTGGCTGAAACAGG + Intronic
967537719 3:190626122-190626144 AGAACTGTTCTGGGCAAACTGGG + Intronic
968833322 4:2944809-2944831 TGAACTTTTTAAGCCAAAAAGGG + Intronic
970816110 4:20157878-20157900 TGAATTTTTTTGGCCAGAAAGGG + Intergenic
971630604 4:28988264-28988286 AGAACTTTTCTGTCTTACAAGGG - Intergenic
972846251 4:42994084-42994106 AGAAATTTATTGGCCAAAGATGG + Intronic
973112254 4:46411009-46411031 TTAAATTTTCTGGCCAAAGAGGG - Intronic
974185658 4:58442548-58442570 AGAACTTTTCTGATAAGAAAAGG + Intergenic
974523269 4:63013333-63013355 AGAAGATTTATGGACAAAAAAGG - Intergenic
980835969 4:138193185-138193207 CCAACATTTCTGACCAAAAAAGG + Intronic
981174331 4:141663540-141663562 AGAACTGTGCTTGGCAAAAACGG + Intronic
985208966 4:187571953-187571975 AGAACATTTGGGGGCAAAAAGGG + Intergenic
985227418 4:187777544-187777566 AAATTTTTTCTGGCCAAAACAGG - Intergenic
985612042 5:894884-894906 TGCACATTTCTGGTCAAAAAAGG - Exonic
986212434 5:5686589-5686611 AGAAGATTTCTGGACAAAAAGGG - Intergenic
988622999 5:32842624-32842646 ACACCTTCTCAGGCCAAAAAAGG + Intergenic
989692390 5:44159514-44159536 AGAATTTTATTGGGCAAAAAGGG - Intergenic
989812717 5:45696414-45696436 AGACCCTTTCTGGCCAACAGAGG - Intergenic
990191370 5:53263831-53263853 AAAACTTTCCTTACCAAAAAAGG - Intergenic
990789612 5:59462592-59462614 AACACTTTTCTGGCCACAGATGG + Intronic
990950167 5:61290905-61290927 AGAACTGTTCTGGGCAAACAGGG - Intergenic
991598643 5:68330448-68330470 ACAACATTTCTGGTCAAAAAAGG - Intergenic
992205839 5:74429685-74429707 AGGAGTTTTCTGGCAAAAAATGG - Intergenic
994591776 5:101783270-101783292 AGAACTTTTCTGTCAAGAGAAGG - Intergenic
994742934 5:103643884-103643906 AGAACCTTTCTGGCCAGGCATGG + Intergenic
994811573 5:104525615-104525637 ATTAATTATCTGGCCAAAAAAGG - Intergenic
994869874 5:105334184-105334206 AAAACTTTTCTGTACAACAAAGG - Intergenic
996353724 5:122574125-122574147 AGAATTCTTCTAGCCAGAAATGG - Intergenic
998958103 5:147457461-147457483 AGAACTTTTCTGGAACTAAAGGG + Intronic
1000434976 5:161197004-161197026 AGAAATTTTCAGTCTAAAAAAGG - Intergenic
1001292666 5:170475179-170475201 AGAACTTTTCTGTCTTACAAGGG - Intronic
1001443571 5:171764585-171764607 AGAAATTTTCTGGCATAAAAGGG + Intergenic
1002854015 6:1021869-1021891 AGAACTTTTCTGTCTTACAAAGG - Intergenic
1003019502 6:2497349-2497371 TTCACTCTTCTGGCCAAAAATGG + Intergenic
1003302342 6:4894814-4894836 ACGACTTTTGTGGACAAAAAAGG - Intronic
1003795892 6:9602765-9602787 AGAAATTTTCTAGCTAAAACAGG + Intronic
1004550146 6:16638974-16638996 AGAACTTTTCTGTCTTACAAGGG + Intronic
1006381288 6:33698968-33698990 GTATCTTTTCTGACCAAAAAAGG + Intronic
1007229925 6:40341058-40341080 GGAAACTTTCTGCCCAAAAAGGG - Intergenic
1008655293 6:53605874-53605896 TCAACTTTTCTGGATAAAAAGGG + Intronic
1011279958 6:85666947-85666969 TTACCTTTTCTGGCCAAAGATGG + Intergenic
1011912426 6:92457751-92457773 AGAGCTTTTATTGACAAAAATGG - Intergenic
1012464091 6:99497909-99497931 AGAAATTATCTGGGCAAAAAGGG - Intronic
1012881310 6:104793854-104793876 AGATATTTACAGGCCAAAAATGG + Intronic
1013308344 6:108870819-108870841 AGAACTTTGTTGGCCTAGAATGG - Intronic
1015058352 6:128931320-128931342 AGCACTTTTCAGGCAATAAATGG + Intronic
1015068609 6:129061178-129061200 AGAACTCTTGTGACCAATAAAGG - Intronic
1016684318 6:146864093-146864115 AGAAAGATTTTGGCCAAAAAAGG - Intergenic
1017785090 6:157749840-157749862 AGAACTGATATGGCCAAAAAAGG + Intronic
1018047239 6:159976681-159976703 AGAACTTTTGAATCCAAAAAGGG - Intronic
1019809375 7:3153460-3153482 TGAAATTTTCTGTACAAAAATGG + Intronic
1020773333 7:12423352-12423374 AGAACATTGCTGGGGAAAAAAGG - Intergenic
1023427010 7:40048346-40048368 AGAACTTTTCTGGCTAAAGTTGG + Intronic
1023796654 7:43799069-43799091 AGAAGCTTTCTGGCACAAAATGG - Intronic
1024511580 7:50208361-50208383 AAGACTTTTCTGGCAAAAGATGG + Intergenic
1026422551 7:70255598-70255620 AGAACTTTTCTTTCCAGAGACGG + Intronic
1026541535 7:71283837-71283859 AGAACTTTTCTGTCTTACAAAGG + Intronic
1027597382 7:80191324-80191346 AAGAGTTTTCTGGACAAAAATGG + Intronic
1028880890 7:95878375-95878397 AGAAATTTTTTGGAAAAAAAAGG + Intronic
1029385275 7:100239434-100239456 AAACCTTTCCTGGCCAGAAATGG + Intronic
1030027490 7:105338808-105338830 AGAACTATTATAACCAAAAAGGG - Intronic
1031031394 7:116739436-116739458 AGATCTTTTCAGGTCAAAACAGG - Intronic
1036184171 8:6609916-6609938 AGAACTTATCCAGACAAAAAAGG - Intronic
1037303336 8:17477634-17477656 AGAACTTTTCTGTCTAGCAAGGG + Intergenic
1038856043 8:31334549-31334571 TGAAATTTTCTGTCCAAACAAGG - Intergenic
1039085105 8:33771948-33771970 AGCACTTTCCTGGCCCACAAAGG + Intergenic
1039834662 8:41246946-41246968 AGAAGGTTTATGGACAAAAAAGG - Intergenic
1039838867 8:41279464-41279486 AGAACCTTTCTGTCCCAGAAAGG + Intronic
1044175557 8:89116723-89116745 AAAAATTTTCTGGCGAAAAAAGG + Intergenic
1044777415 8:95705380-95705402 AGATCTTTTCTTCCCAAATATGG + Intergenic
1046243562 8:111530357-111530379 AGAACATTTCTGGCAACAAAAGG + Intergenic
1047187579 8:122647787-122647809 AGTACTGTACTGGCCACAAAAGG + Intergenic
1047540914 8:125765531-125765553 AGAACTTTTCTAAGCAGAAAAGG - Intergenic
1048225804 8:132584252-132584274 AGGACTTTTTAGACCAAAAAGGG - Intronic
1048271845 8:133035439-133035461 ATAACTTTTCTGCCAACAAATGG - Intronic
1048908912 8:139115583-139115605 AGAACTTTTCTTGCAGAAACTGG - Intergenic
1050056242 9:1658393-1658415 AGAACATTTTTGGCTAACAAGGG + Intergenic
1050970749 9:11869610-11869632 AGAACCTTTCTGGCACAAAGTGG - Intergenic
1051955924 9:22693217-22693239 ATAGATTTTCTTGCCAAAAAGGG + Intergenic
1052926496 9:34021175-34021197 AGACCTTTTCTGGCTAAAATAGG - Intronic
1055454838 9:76462428-76462450 AGAATTTAACTGGCCAAAAATGG - Intronic
1055786649 9:79876847-79876869 AAAACTTTTCTGACTATAAAAGG + Intergenic
1056644680 9:88400497-88400519 AGATTTTTTCTGGCCTAACAAGG + Intronic
1057588537 9:96350907-96350929 AGAAATTTTCTGGCCAATGTGGG + Intronic
1058301264 9:103375795-103375817 AGAAATTTTCTGGCCAGGCACGG - Intergenic
1058888337 9:109339981-109340003 AAAAATTTTCTGGCCAAGAGTGG - Intergenic
1060253700 9:122006692-122006714 AGAGCTTTTCTGGCCACATGTGG + Intronic
1185756611 X:2658722-2658744 AGAACTTTTCTTGATAATAATGG - Intergenic
1186876061 X:13819377-13819399 AGAACTTTTCTGGCCAAAAATGG - Intronic
1187556967 X:20361371-20361393 AGAATTTTTGTGGCAAAACATGG + Intergenic
1188686147 X:33072972-33072994 CTAAATTTTCTGGCCAAATAGGG - Intronic
1188723540 X:33551965-33551987 AGAGCTTCTCTGGCAAAACATGG - Intergenic
1188939661 X:36221274-36221296 AGAACTTTACTTGCCTATAATGG - Intergenic
1193917349 X:87381440-87381462 AGAATTTTTCAGGCAAACAAAGG + Intergenic
1194265172 X:91744200-91744222 AGAGCTTTTCTGGGCACTAAGGG - Intergenic
1194446694 X:93996289-93996311 AGTACTATTCTGCCCTAAAAAGG - Intergenic
1194611651 X:96052019-96052041 AGAACTTTTTTTTCCAGAAACGG + Intergenic
1195997883 X:110749592-110749614 ACTACTTTGATGGCCAAAAATGG + Intronic
1197644123 X:128999176-128999198 TGAAATTACCTGGCCAAAAATGG + Intergenic
1198465843 X:136904124-136904146 AGAACTTTTCTGTCTTACAAGGG + Intergenic
1199159903 X:144596838-144596860 GGACCTTTCCTGGGCAAAAAGGG - Intergenic
1200582324 Y:4964646-4964668 AGAGCTTTTCTGGGCACTAAGGG - Intergenic