ID: 1186877993

View in Genome Browser
Species Human (GRCh38)
Location X:13835855-13835877
Sequence ATGTAAAAGTTGAATGAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 429
Summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 397}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186877993_1186877994 -3 Left 1186877993 X:13835855-13835877 CCAACTTCATTCAACTTTTACAT 0: 1
1: 0
2: 0
3: 31
4: 397
Right 1186877994 X:13835875-13835897 CATTTTATAGTAAAACACAGAGG 0: 1
1: 0
2: 4
3: 43
4: 362

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186877993 Original CRISPR ATGTAAAAGTTGAATGAAGT TGG (reversed) Intronic
901494024 1:9611161-9611183 ATGTGAAAGTTGAAAGTTGTAGG - Intronic
902162584 1:14543292-14543314 ATTAATAAGTTGCATGAAGTTGG + Intergenic
903090965 1:20916659-20916681 TTGAAAAAGAAGAATGAAGTTGG + Intronic
903582781 1:24384677-24384699 AAGTAAATGTTGACAGAAGTTGG + Intronic
903586898 1:24422930-24422952 ATGTTAAATTTTAATGAAGAGGG + Intronic
903979225 1:27173488-27173510 CTTCAAAAGTTGAATGAATTAGG - Intergenic
906470685 1:46127949-46127971 ATGTAAAAGTTGAATCCAAATGG - Intronic
907523792 1:55041767-55041789 AAATAAAAATTGAATGAATTGGG - Intronic
908629630 1:66088122-66088144 AAGTAAAGGTTAAATGAACTTGG + Intronic
908901169 1:68958209-68958231 ATGTAAATGCTGAAAGAATTAGG + Intergenic
910524566 1:88163368-88163390 AAGCAAAAGGTGAAAGAAGTGGG + Intergenic
911843865 1:102722756-102722778 TAGTAAAAGTTGAATGAAAGTGG + Intergenic
912023100 1:105131672-105131694 CTTCAAAAGTTGAATGAATTGGG - Intergenic
913468440 1:119167362-119167384 TTGAAAAAGTAGAATAAAGTTGG - Intergenic
914978334 1:152388143-152388165 CTCTAAAAGTAGAATGAGGTTGG - Intergenic
915032791 1:152898076-152898098 CTTCAAAAGTTGAATGAATTGGG - Intergenic
915050179 1:153061188-153061210 ATATATTATTTGAATGAAGTGGG + Intergenic
915781717 1:158559177-158559199 CTTCAAAAGTTGAATGAATTGGG + Intergenic
916074460 1:161192339-161192361 TCGGAAAAGTTGGATGAAGTAGG + Intronic
918106385 1:181418910-181418932 ATGTAATAATTGATTGAAGCTGG + Intronic
918562054 1:185880740-185880762 ATGAAATAGGGGAATGAAGTTGG + Intronic
918577491 1:186080425-186080447 ATGAAAATGTTAAATGAACTAGG - Intronic
918648225 1:186926688-186926710 AATTAAATGTTGAATGAATTTGG + Intronic
918957217 1:191223932-191223954 ATGCAAAAATTGAATGACTTGGG - Intergenic
919274669 1:195398162-195398184 ATTCAAAAGTTGAATGAATTGGG - Intergenic
921050958 1:211511406-211511428 ATGTAAAACTAGAATGAAAGAGG - Intergenic
921750507 1:218787422-218787444 CTTCAAAAGTTGAATGAATTGGG - Intergenic
922392564 1:225160642-225160664 TTTTAAAACTTGAATGAAATGGG - Intronic
924410635 1:243801408-243801430 ATGTAAATGTTCAATGAAACAGG + Intronic
924832002 1:247606053-247606075 AGGTAAAAGTTGCATGGATTAGG - Exonic
1064749552 10:18512874-18512896 CTTCAAAAGTTGAATGAATTGGG - Intronic
1064953288 10:20878732-20878754 ATGCAAAGGTTGAGTCAAGTCGG + Intronic
1066205951 10:33189398-33189420 ATGTAAAAGATGACGGAAGAGGG - Intronic
1068040036 10:51812362-51812384 TTTCAAAAGTTGAATGAATTGGG - Intronic
1068226228 10:54110008-54110030 AAGTACAAGTGGAATGAAGAAGG + Intronic
1068972935 10:62978157-62978179 TTGTGAAAGTTGAATCTAGTTGG - Intergenic
1069520416 10:69115425-69115447 CTTCAAAAGTTGAATGAATTGGG + Intergenic
1069666748 10:70167354-70167376 ATGAAAATTTTGAATGCAGTTGG - Intronic
1070225526 10:74500285-74500307 ATGTAAAACTTGACTGGAGTGGG - Intronic
1070640307 10:78164031-78164053 ATGAAAAAGTTCAATTAATTGGG - Intergenic
1072042286 10:91619546-91619568 CTTCAAAAGTTGAATGAATTGGG - Intergenic
1073211419 10:101806001-101806023 CAGTCAAAGTTGAATTAAGTAGG - Intronic
1073888105 10:108064932-108064954 ATGTAAAAGATTCATGAGGTGGG + Intergenic
1074444612 10:113509784-113509806 GTTCAAAAGTTGAATGAACTGGG + Intergenic
1074658971 10:115628763-115628785 TTGCAAAAATAGAATGAAGTTGG - Intronic
1075569911 10:123533306-123533328 ATCAAAAAGTTAAATCAAGTGGG + Intergenic
1075822430 10:125326386-125326408 ATAGAAAAGTTGAATGAACTGGG - Intergenic
1078684397 11:13514649-13514671 AAGAAAAAGAAGAATGAAGTTGG + Intergenic
1079854580 11:25586162-25586184 ATTAAAAAGTTGAAGGAATTGGG - Intergenic
1079876906 11:25869988-25870010 ATGTAGAAGTTGATGGAAGATGG + Intergenic
1080436810 11:32252490-32252512 ATGTAAAACTTCAATAATGTGGG + Intergenic
1080913118 11:36625842-36625864 AGGTAAAATTTGAATAAAGTTGG + Intronic
1081249083 11:40807131-40807153 GAGTAAAAGTTGACTGAAGTTGG - Intronic
1082934246 11:58639896-58639918 CTGTAACAGATGAAGGAAGTGGG - Intergenic
1086139947 11:83486204-83486226 ATGTAAAAGTGGCATGAAACTGG - Intronic
1086403816 11:86483210-86483232 ATGTAAAGGTAGAAACAAGTGGG + Intronic
1086478836 11:87211235-87211257 ATATGAAATTTTAATGAAGTTGG + Intronic
1086854863 11:91854040-91854062 ATCTAAAGGTTGACTGAAGGTGG + Intergenic
1086922427 11:92602401-92602423 ATGTAAAAATTAAATAAGGTAGG - Intronic
1086990181 11:93294318-93294340 ATGGAAAAGTTGAAAGTAGTTGG + Intergenic
1087055613 11:93933082-93933104 ATGAAGACATTGAATGAAGTGGG - Intergenic
1087436781 11:98129796-98129818 AGGAAAATGTTGAATAAAGTAGG + Intergenic
1087570349 11:99919432-99919454 ATGTAGTAGCTGAATGAAGAGGG - Intronic
1087882300 11:103431840-103431862 CTTCAAAAGTTGAATGAATTGGG - Intronic
1088639731 11:111859930-111859952 TTGTATAAGCTGAATCAAGTTGG - Intronic
1088763479 11:112954074-112954096 TTGAAAAAGAAGAATGAAGTTGG + Intergenic
1089576498 11:119448026-119448048 TTTTAAAAATTGAATGAAATGGG - Intergenic
1090122750 11:124049907-124049929 TAGTAAATGTTTAATGAAGTTGG - Intergenic
1092307259 12:7314140-7314162 ATGTAGAAGATGAAGGAAGAAGG + Intronic
1092513496 12:9183783-9183805 AAGTCAAATTTGCATGAAGTTGG - Intronic
1092778349 12:11963433-11963455 ATGGAAAAAGTAAATGAAGTTGG + Intergenic
1093383222 12:18520706-18520728 ATGGAAAAATTGACAGAAGTAGG - Intronic
1095580033 12:43787353-43787375 ATGACAAAGTTGAAGGAATTTGG + Exonic
1095901247 12:47330616-47330638 TTGAAAAAATAGAATGAAGTGGG - Intergenic
1097093401 12:56525633-56525655 ATATAAAAGTTGGCTGAGGTGGG - Intronic
1097946799 12:65377637-65377659 AAATAAAAGTTCCATGAAGTTGG + Intronic
1098229338 12:68357111-68357133 ATGGAACAGATGAATGAAGTAGG - Intergenic
1098376947 12:69826086-69826108 ATTTAAAAGTTGAATGGAATGGG + Intronic
1099002312 12:77193212-77193234 AGGTAAAAGTTTAAAGTAGTTGG - Intergenic
1099259166 12:80354975-80354997 ATGTAAATGTTATATGAGGTAGG + Intronic
1099359290 12:81679560-81679582 ATGTAGAAGATGAATGAAAAGGG + Intronic
1099463413 12:82952293-82952315 ATGTAATAGGTGTATGAAATTGG - Intronic
1099470011 12:83036632-83036654 ATTTAAAAGTTGAAAGAGCTGGG - Intronic
1099869638 12:88330700-88330722 GTGTTAAAATTGCATGAAGTAGG + Intergenic
1100111527 12:91249351-91249373 ATGTAAAAGTTAGATAAACTGGG - Intergenic
1100277914 12:93088496-93088518 ATGGGAAAGTTGAGTGAAGCAGG - Intergenic
1100527694 12:95435223-95435245 CTTCAAAAGTTGAATGAACTGGG + Intergenic
1101165003 12:102020274-102020296 AAGTAAAGGTAGAATGAGGTGGG + Intronic
1101387323 12:104269298-104269320 ATGTAAAATTTGAATGGATGAGG - Intronic
1103840960 12:123863923-123863945 ATGTAAGAGAAGAATGAGGTAGG + Intronic
1104150433 12:126076906-126076928 GTGTAAAAGTTTTATGATGTAGG + Intergenic
1104654876 12:130567048-130567070 ATGAAAGAGGTGAAGGAAGTTGG + Intronic
1104683752 12:130771000-130771022 ATGAGATAGTTGAATGAGGTTGG - Intergenic
1105271873 13:18884160-18884182 TTTCAAAAGTTGAATGAACTGGG + Intergenic
1106143561 13:27032336-27032358 TTGAAAAAGAAGAATGAAGTTGG + Intergenic
1106690987 13:32116332-32116354 ATGTAAAACTACAATGAAATGGG - Intronic
1107078511 13:36348915-36348937 TTGAAAAAGAAGAATGAAGTTGG + Intronic
1108285455 13:48903147-48903169 ATGGTAGAGTTGAAAGAAGTTGG + Intergenic
1108805003 13:54143647-54143669 ATATATAAGTTCTATGAAGTTGG - Intergenic
1108870091 13:54974251-54974273 GTGTAAAAGTTGAAAGAGGCCGG - Intergenic
1109688356 13:65850465-65850487 CTTCAAAAGTTGAATGAACTGGG - Intergenic
1110726768 13:78834577-78834599 ATTAACAATTTGAATGAAGTTGG + Intergenic
1111187851 13:84763841-84763863 ATGTAAAGAATGAATGAAGGAGG + Intergenic
1111257161 13:85685463-85685485 ATGGAAAAGTTGACTGAACAGGG + Intergenic
1111719595 13:91925293-91925315 ATTTAAAATTTAAATGAAGCAGG + Intronic
1111868856 13:93804818-93804840 ATGTAATAGCTGCATGACGTTGG + Intronic
1111912929 13:94331780-94331802 AAGTAAAAGGTGAATTAATTTGG + Intronic
1112934169 13:104778580-104778602 ATATAACAGTTGAATAATGTAGG - Intergenic
1115872252 14:37817668-37817690 ATGTCAAAGTGGAATCAAGCAGG + Intronic
1116168120 14:41360666-41360688 AATTAAAAGTGGAATCAAGTAGG - Intergenic
1117512237 14:56464452-56464474 ATGTAAAAGTTGAATCAGACTGG - Intergenic
1117662608 14:58022771-58022793 ATGTACAAAATGAATGAAATTGG - Intronic
1118490711 14:66256725-66256747 CTTCAAAAGTTGAATGAATTAGG - Intergenic
1119008053 14:70952401-70952423 AGGGAAAAGTGGAATGAAATGGG - Intronic
1119089620 14:71769426-71769448 TTGAAAAAGAAGAATGAAGTTGG + Intergenic
1119828818 14:77682605-77682627 TAGTAAAAGATGAAAGAAGTTGG + Intronic
1120080731 14:80213221-80213243 ATGAAAAAGTAGAATAAAGTGGG - Intronic
1120275329 14:82366304-82366326 ACTTAAAAGTTGAATGAATTGGG + Intergenic
1121476075 14:94204524-94204546 TTGAAAAAGAGGAATGAAGTAGG - Intronic
1121481260 14:94276781-94276803 TTCTAAATTTTGAATGAAGTTGG - Intronic
1121805712 14:96819829-96819851 CTCCAAAAGTTGAATGAATTGGG - Intronic
1123486315 15:20742827-20742849 TTTCAAAAGTTGAATGAATTGGG + Intergenic
1123542806 15:21311883-21311905 TTTCAAAAGTTGAATGAATTGGG + Intergenic
1123739644 15:23224533-23224555 ATTTAAAATTTAAATGAAGCAGG + Intergenic
1124131318 15:26989466-26989488 ATAAAAAAGTTGAATAAAATCGG - Intronic
1124290867 15:28453504-28453526 ATTTAAAATTTAAATGAAGCAGG + Intergenic
1125052369 15:35315154-35315176 CTTCAAAAGTTGAATGAATTGGG + Intronic
1125624386 15:41094957-41094979 ATATAAAAGATAAATGAATTTGG + Intronic
1128625414 15:69197183-69197205 CTTCAAAAGTTGAATGAATTGGG + Intronic
1128642522 15:69350094-69350116 TTGGAAAAGTTAAATGCAGTGGG + Intronic
1130264473 15:82387573-82387595 GTTCAAAAGTTAAATGAAGTAGG + Intergenic
1130637687 15:85640774-85640796 AAGTAAAGGTTAAATGAGGTTGG + Intronic
1130685319 15:86032041-86032063 ACGTAAAAGTTGAATCAGATTGG - Intergenic
1130748971 15:86689033-86689055 ATATAAAAGTAAAATGAAATAGG - Intronic
1132290436 15:100697521-100697543 GTGAAAATGTTGAAAGAAGTAGG + Intergenic
1202951124 15_KI270727v1_random:39013-39035 TTTCAAAAGTTGAATGAATTGGG + Intergenic
1132913864 16:2331108-2331130 ATGCAAAACTTGTATGAAGTTGG - Intronic
1134819932 16:17238832-17238854 TTGGAAAAGTTGATAGAAGTGGG - Intronic
1135526388 16:23216432-23216454 ATGTGAATGTGGTATGAAGTGGG - Exonic
1136760014 16:32725260-32725282 ATTTAAAATTTAAATGAAGCAGG + Intergenic
1136808090 16:33145126-33145148 ATTTAAAATTTAAATGAAGCAGG - Intergenic
1138241548 16:55431360-55431382 ATGTAAAGAGTGAATGAAGCCGG - Intronic
1138273675 16:55715049-55715071 CTTCAAAAGTTGAATGAATTGGG + Intergenic
1138760495 16:59538265-59538287 ATGTAAAAGTTGAACCAGATTGG - Intergenic
1138926387 16:61596576-61596598 ATGAGAAAGTGGAAGGAAGTAGG - Intergenic
1139074719 16:63430144-63430166 CTTCAAAAGTTGAATGAATTGGG - Intergenic
1140572895 16:76129555-76129577 ATGTCAGAGTTGAATCAAGACGG - Intergenic
1203062170 16_KI270728v1_random:985581-985603 ATTTAAAATTTAAATGAAGCAGG + Intergenic
1143707644 17:8710156-8710178 ATGTAACAGCTGGAAGAAGTAGG - Intergenic
1144242374 17:13325583-13325605 ATGTAAAAATTGATACAAGTGGG + Intergenic
1146956691 17:36940169-36940191 ATGTAAAAAGTGGAGGAAGTAGG - Intronic
1147893056 17:43730923-43730945 ATGTACCAATTGAATGATGTTGG - Intergenic
1149167271 17:53767490-53767512 CTTCAAAAGTTGAATGAATTGGG - Intergenic
1149754526 17:59176054-59176076 ATGTAAAAGTTGCAAGATGAGGG + Intronic
1153215422 18:2816183-2816205 ATGTAAGAGTTGGGTGAGGTAGG + Intergenic
1153479565 18:5533805-5533827 ATTTAAAAGGTTAAGGAAGTAGG - Intronic
1155659726 18:28233811-28233833 CTTCAAAAGTTGAATGAATTGGG - Intergenic
1155778002 18:29792780-29792802 CTTCAAAAGTTGAATGAATTGGG - Intergenic
1155839356 18:30627836-30627858 ATGAAAAAGCTGAAGGAAATAGG - Intergenic
1157967938 18:52229867-52229889 ATGTAAGAGTTGGATGAGGGTGG + Intergenic
1158345618 18:56513600-56513622 ATGTAAAATTTCATTAAAGTAGG - Intergenic
1158356615 18:56627755-56627777 ATGTAAAAGGTGAAACAAGGAGG + Intronic
1158990014 18:62858633-62858655 ATATAAAATGTGAATGAAGCTGG + Intronic
1159051638 18:63426013-63426035 ATATAAAAGCTGAATGAATTGGG - Intergenic
1159185253 18:64963173-64963195 ATGGAAAAGTTGAAAGAATAAGG - Intergenic
1159722986 18:71916410-71916432 CTTCAAAAGTTGAATGAAATGGG + Intergenic
1159746314 18:72240237-72240259 TTGAAGAAGATGAATGAAGTTGG - Intergenic
1160326495 18:77954277-77954299 ATGTAAAAAATGAATGAATCAGG + Intergenic
1167703011 19:51061673-51061695 ATGTAAAAGTGGAAGGATTTAGG - Intronic
925048397 2:791700-791722 CTTCAAAAGTTGAATGAATTGGG - Intergenic
925527282 2:4816835-4816857 AAGCAAAGGTAGAATGAAGTGGG - Intergenic
926477542 2:13344664-13344686 TTGAAAAAGAAGAATGAAGTTGG + Intergenic
926488540 2:13494573-13494595 ATTTAAAAGTTGATTTAACTTGG + Intergenic
927457275 2:23264720-23264742 TTGAAAAAGTTGAACAAAGTTGG - Intergenic
928475483 2:31622508-31622530 CTTCAAAAGTTGAATGAATTGGG - Intergenic
930627526 2:53714720-53714742 ATGTAATAGTTTAATGTTGTTGG - Intronic
930981616 2:57532552-57532574 ATATAAGAGTTTAATGAAGTTGG - Intergenic
931019099 2:58022477-58022499 TTGTAAAAGTTGAGGGGAGTAGG + Intronic
932265098 2:70361090-70361112 ATGAAAAAGTTGACTGGAGGAGG - Intergenic
932889285 2:75577928-75577950 AGGTAGAAGGTGAATGAAGTTGG + Intergenic
934114363 2:88771547-88771569 ATGTAAAAGTTGATTAAGCTGGG + Intergenic
936658158 2:114512289-114512311 ATGTGAAAGGTGAAGGAAATTGG - Intronic
936660013 2:114532777-114532799 ATGTAAACTTTCCATGAAGTTGG - Intronic
936736707 2:115452664-115452686 ATGTAAAAGTTAAAAAAAGAAGG - Intronic
938660771 2:133484737-133484759 ATGTGAAATATAAATGAAGTTGG + Intronic
939682260 2:145152225-145152247 CTTCAAAAGTTGAATGAATTGGG + Intergenic
940592716 2:155749394-155749416 ATGGAAAAATTGACAGAAGTAGG + Intergenic
942078768 2:172381251-172381273 TTTAAAATGTTGAATGAAGTGGG + Intergenic
942569374 2:177297890-177297912 ATAGAATAGTTGAATTAAGTTGG + Intronic
942702995 2:178734774-178734796 ATGTAAAAGTTGAAGACAGTGGG - Exonic
943217167 2:185052928-185052950 ATTAAAAAGTTGAATGCAATAGG + Intergenic
943554131 2:189380156-189380178 ATGTCAAAGATGAATGGAATGGG + Intergenic
943559633 2:189445220-189445242 ATGTATTAGCTGAATGATGTTGG - Intronic
943695150 2:190919656-190919678 CTGCAACAGTTCAATGAAGTTGG + Intronic
943709073 2:191069924-191069946 ATATAAAAGTTGGATAATGTTGG + Intronic
944003164 2:194867067-194867089 TTGTAAAAATTGCATGGAGTTGG + Intergenic
944044648 2:195395386-195395408 ATATAAAAGCTGAATGTTGTGGG - Intergenic
944123840 2:196270992-196271014 GTATAAAAGTTGAATAAAATCGG - Intronic
944358353 2:198820760-198820782 ATGTAAAATTTGAAATAAATGGG + Intergenic
944385243 2:199155962-199155984 ATGGACAAGTTGACAGAAGTAGG + Intergenic
944550845 2:200843504-200843526 CTTCAAAAGTTGAATGAATTGGG - Intergenic
945264693 2:207879453-207879475 ATGCAAAGGTTGAATGCACTTGG - Intronic
945618982 2:212109473-212109495 AAGTAATAGCTGAAAGAAGTGGG - Intronic
946436068 2:219655431-219655453 TTGTAAAAGGAGAATAAAGTGGG + Intergenic
947756899 2:232572743-232572765 ATGTAATACTGGAATGGAGTAGG + Intronic
1168745412 20:235290-235312 CTTCAAAAGTTGAATGAATTGGG + Intergenic
1169061143 20:2661084-2661106 ATTTAAAAGTTTACTGATGTGGG - Intronic
1169255923 20:4098643-4098665 TTGTAAAAGAAGAATAAAGTTGG + Intergenic
1169719252 20:8655638-8655660 ATGTGTACGTTGAGTGAAGTTGG + Intronic
1169783529 20:9334131-9334153 ATGTAAAAGTTGAGTACAGAAGG + Intronic
1170434677 20:16314348-16314370 TCTTAAAAGTTGATTGAAGTTGG + Intronic
1173348753 20:42225179-42225201 ATTTGAAAATAGAATGAAGTAGG - Intronic
1173382093 20:42554841-42554863 ATGTAAAAGGTGAGGCAAGTTGG + Intronic
1174341368 20:49898532-49898554 ATTTAAAAGTTTGATGTAGTCGG - Intergenic
1174602275 20:51734351-51734373 ATCTGATAGTTGTATGAAGTTGG - Intronic
1174706862 20:52665281-52665303 AAATAAAAGTGGAAAGAAGTTGG + Intergenic
1175039498 20:56033903-56033925 ATTTACAAGTAGAATGTAGTAGG + Intergenic
1176929726 21:14794592-14794614 GTGTAAAAGTAGAATGAACGTGG - Intergenic
1176945983 21:14982149-14982171 ACTTAAGAGTTGAATGAACTAGG - Intronic
1177218803 21:18164030-18164052 ATATAAAAGTTTAATGCATTTGG - Intronic
1177361585 21:20078947-20078969 AATAAAAAGTTGAATGAATTGGG + Intergenic
1177689556 21:24487512-24487534 TTGCAAACATTGAATGAAGTAGG + Intergenic
1178627573 21:34231079-34231101 ATGCAAAAGAAGAATTAAGTGGG - Intergenic
1179214738 21:39357767-39357789 CTTCAAAAGTTGAATGAATTAGG - Intergenic
1182643188 22:31785656-31785678 TTGTAAAAGGGGAACGAAGTTGG + Intronic
1184804262 22:46782365-46782387 ATTTAAAGGTTGAATGAATGAGG + Intronic
949463248 3:4316986-4317008 CTTCAAAAGTTGAATGAATTGGG + Exonic
949624884 3:5854073-5854095 ATGTGAAAGTTTAAGGAATTTGG + Intergenic
949694083 3:6674096-6674118 CTGTCAAAGTTGAATGAATTGGG + Intergenic
951115028 3:18850911-18850933 ATGTAACAACTGAATGAAATAGG - Intergenic
951698726 3:25472751-25472773 ATGTCAAAGCTGAATGAACTAGG - Intronic
951764559 3:26183274-26183296 ATGTAAAAGATGATGGGAGTTGG - Intergenic
951975383 3:28501515-28501537 ATGAAAAAGTTGAGTCAAGTTGG - Intronic
952182048 3:30927276-30927298 ATCTTAAAGTTGAATGAAAAAGG + Intergenic
952667762 3:35927733-35927755 CAGTGAAAGTTGAATCAAGTGGG + Intergenic
952773387 3:37022111-37022133 ATCTGAAAGTTGAGTGCAGTGGG + Intronic
952985795 3:38781476-38781498 CTTCAAAAGTTGAATGAATTGGG + Intronic
953230052 3:41056661-41056683 TGGTAAAATTTGAATGAAGTTGG - Intergenic
954233245 3:49235146-49235168 AGGTAAAAATTGGATGAACTTGG - Intronic
954957409 3:54533838-54533860 GTGTAAATGTTGAAGCAAGTGGG + Intronic
955167744 3:56531017-56531039 AAGTAAATGTTTAATAAAGTGGG - Intergenic
955937821 3:64119369-64119391 AAATAAAAGTTGAAAGAAATGGG + Intronic
956060754 3:65345724-65345746 ATTCAAAAGATGAATTAAGTGGG + Intergenic
956203213 3:66728976-66728998 ACAAAAAAGTTGAATGAAGATGG - Intergenic
957544286 3:81616634-81616656 TTGTAAAAGTGGAATAAAGTGGG - Intronic
957841927 3:85683180-85683202 ATATAAAAGTTAAATGATTTAGG - Intronic
957993423 3:87655536-87655558 GTGAATAAATTGAATGAAGTAGG - Intergenic
958008693 3:87846485-87846507 ATGATAAAGTTGTATAAAGTTGG - Intergenic
958491089 3:94774517-94774539 CTTCAAAAGTTGAATGAATTGGG + Intergenic
958534179 3:95375531-95375553 ATTCAAAAGTTGAATTAATTGGG + Intergenic
958590099 3:96146085-96146107 ATTTTAAAGTTGAATGCAGAAGG - Intergenic
958854659 3:99370204-99370226 CTTCAAAAGTTGAATGAATTGGG - Intergenic
960417324 3:117400324-117400346 GTGTAAAACTGAAATGAAGTTGG + Intergenic
960424902 3:117494271-117494293 ATTTTACATTTGAATGAAGTGGG + Intergenic
961227523 3:125265645-125265667 AACTAAAAGTTAGATGAAGTGGG + Intronic
961348542 3:126282163-126282185 TTGAAAAAGAAGAATGAAGTTGG - Intergenic
961498317 3:127310923-127310945 AGGCAAATGTTGGATGAAGTAGG + Intergenic
962011895 3:131399912-131399934 ATCTAACAGCTGATTGAAGTGGG - Intergenic
962266987 3:133950865-133950887 ATGTAAAAGTTGACTGTACCAGG + Intronic
962368768 3:134803772-134803794 ATGGAAAAGGTGACTGAACTGGG - Intronic
962792030 3:138820286-138820308 ATGTGAAAGGTGAATTATGTAGG - Intronic
963548778 3:146695260-146695282 ATAGAAGAGTTGAATGAGGTTGG + Intergenic
964946290 3:162229452-162229474 AATTAAAAGTTGTATGAATTGGG - Intergenic
965354774 3:167660155-167660177 ATTTGCAAGTTGTATGAAGTTGG - Intergenic
965853727 3:173063351-173063373 ATGCAAAAGTGGAAAGAAGAAGG + Intronic
966098451 3:176236298-176236320 ATGAAGAAGTAGAATGCAGTAGG + Intergenic
968330025 3:197860288-197860310 ATTTAGAAGTTGAAGGAGGTTGG - Intronic
970264160 4:14262807-14262829 TTTCAAAAGTTGAATGAATTGGG - Intergenic
971232447 4:24810668-24810690 ATGTAAATGTTGAATGAAAATGG + Intronic
972386057 4:38566848-38566870 ATGCAAAAGTAAAAAGAAGTGGG + Intergenic
974146266 4:57951902-57951924 ATGGAAAAATTGATAGAAGTTGG + Intergenic
975407737 4:74011124-74011146 TGATAAAAGTTGAATGAATTAGG + Intergenic
975725551 4:77288096-77288118 CTTCAAAAGTTGAATGAATTAGG - Intronic
977004946 4:91555021-91555043 ATGTAAAAATTGACTCAAATTGG + Intronic
977035201 4:91942469-91942491 ATTTGAAAGTTAAATTAAGTTGG + Intergenic
977690112 4:99896482-99896504 TTGTATAAGTTAAATGAAATTGG - Exonic
978279249 4:106989894-106989916 ATTTAAAAGTTAAATGAAACAGG + Intronic
978595271 4:110370702-110370724 CTTCAAAAGTTGAATGAATTGGG + Intronic
978831435 4:113090009-113090031 GAGTAAAAGTTGAATGGAATCGG + Intronic
978991962 4:115095087-115095109 CTGTAAGATTTGAATGAGGTGGG - Intronic
979614782 4:122730245-122730267 ATTTTAAAGTTTGATGAAGTTGG - Intergenic
980248737 4:130284699-130284721 CTTTAAAAGTTGAATGAATTGGG + Intergenic
980317676 4:131223923-131223945 AAGTAAATGTTTAATGATGTTGG + Intergenic
980525286 4:133983022-133983044 ATGTAAAACTTGAGACAAGTTGG - Intergenic
980764860 4:137288605-137288627 CTTTAAAAGTTGAATGAATTGGG + Intergenic
981894300 4:149779316-149779338 TTGAAAAAGATGAATAAAGTGGG + Intergenic
982330218 4:154173366-154173388 AAGCAAAAGTTGAAAGAACTAGG - Intergenic
982365896 4:154578142-154578164 ATGAAAAAGATGAGTGAATTTGG + Intergenic
982716118 4:158810256-158810278 TTGGACAGGTTGAATGAAGTGGG + Intronic
982887046 4:160794792-160794814 ATGAAAAGGCTCAATGAAGTTGG + Intergenic
983210254 4:164951363-164951385 TGGAAGAAGTTGAATGAAGTTGG - Intergenic
983933098 4:173474458-173474480 ATATAAAATTTAAATGAAGTGGG + Intergenic
985059499 4:186062514-186062536 AAGTAAAAGTGGAAAGAACTGGG - Intergenic
985151966 4:186956109-186956131 CTGGAAAGGTTGAATGGAGTCGG + Intergenic
985201093 4:187486295-187486317 ATGTATAAATTAAATGCAGTTGG - Intergenic
985930535 5:3053839-3053861 ATGTAAAAATTGAATGCTATTGG + Intergenic
986412670 5:7496491-7496513 ATATAATAGCTGAATGAATTCGG + Intronic
986598949 5:9452059-9452081 GTGGAAAAGGTGAAGGAAGTGGG - Intronic
986819139 5:11446277-11446299 ATGCAAAATTTTAATGAAATCGG + Intronic
987234520 5:15929321-15929343 TTTTAAAAATTGAAGGAAGTCGG + Intronic
988780226 5:34514025-34514047 AGGCAAATGTTTAATGAAGTGGG - Intergenic
991468102 5:66936260-66936282 ATGTAATAGTTGCATGATCTTGG + Intronic
992386713 5:76291622-76291644 ATGTAAAAGTTAAAGGTAATTGG - Intronic
992398411 5:76388685-76388707 ATGAAATAGCTGAATGAAGAAGG - Intergenic
992802459 5:80305935-80305957 TTGGAAAAGGAGAATGAAGTAGG - Intergenic
993477499 5:88383145-88383167 AAGTTCAATTTGAATGAAGTTGG + Intergenic
993632049 5:90298333-90298355 CTGTAAAAGTTTATAGAAGTGGG - Intergenic
993695431 5:91056109-91056131 CTTCAAAAGTTGAATGAATTGGG - Intronic
994843037 5:104951031-104951053 ATGGAAAAATTGACAGAAGTAGG - Intergenic
995536329 5:113140198-113140220 AAGATAAAGATGAATGAAGTAGG + Intronic
996151583 5:120042950-120042972 ATGTTAAAGTTGAGTGAAATAGG + Intergenic
996321039 5:122217282-122217304 AAGTAAACATTGTATGAAGTAGG + Intergenic
996485432 5:124028063-124028085 AAGTAGAAGTTGATGGAAGTGGG - Intergenic
996760756 5:126983860-126983882 ATGAAAAAGATGAAGGAAGCTGG - Intronic
998976806 5:147657996-147658018 ATGGACAAGTTGACAGAAGTAGG - Intronic
999691343 5:154148596-154148618 ATACAGTAGTTGAATGAAGTAGG - Intronic
1000098206 5:157989469-157989491 ATTTAAAAATTGACTGAAATTGG - Intergenic
1000366655 5:160497576-160497598 ATGTAAAAATTCAATCAAGATGG + Intergenic
1000701102 5:164451581-164451603 TTTCAAAAGTTGAATGAATTGGG - Intergenic
1000901690 5:166918963-166918985 ATGTAAAACTTTAATGAGATTGG - Intergenic
1003258841 6:4497750-4497772 AAATAACAGCTGAATGAAGTGGG + Intergenic
1004681211 6:17896436-17896458 ATGTAAATGTTGAAAGAAAGTGG - Intronic
1004964379 6:20831368-20831390 CTTCAAAAGTTGAATGAATTGGG - Intronic
1005054322 6:21715834-21715856 ATGTAAAGCTTAAAAGAAGTAGG - Intergenic
1005396937 6:25392514-25392536 AAGGAAAAGCTGAAGGAAGTAGG - Intronic
1006278471 6:33026758-33026780 ATGTTTAAGTTTGATGAAGTTGG + Intergenic
1008701089 6:54100973-54100995 TTGTAAAAGATTAATTAAGTGGG - Intronic
1008835757 6:55826539-55826561 CTCTAAAATTAGAATGAAGTTGG + Intronic
1009300773 6:62016203-62016225 ATTTAATAGTAGAATGAGGTAGG + Intronic
1009949232 6:70376361-70376383 TTGTATATGTTGAATGGAGTAGG - Intergenic
1010873922 6:81077580-81077602 ATGTAAAAGTGGTATGAACTTGG - Intergenic
1011737690 6:90328621-90328643 TTCTAAAAATTGAATGAAATTGG - Intergenic
1012168157 6:95985010-95985032 CTGTAAAAGTTGTATGCTGTGGG + Intergenic
1014149080 6:118032613-118032635 CTGTAACAGTTAAATCAAGTTGG - Intronic
1014302515 6:119700108-119700130 ATTTAAATGTTGAGAGAAGTTGG - Intergenic
1014370682 6:120603638-120603660 ATTTAAAACCTGAATGAAGGAGG + Intergenic
1014982268 6:127958728-127958750 CTTCAAAAGTTGAATGAATTGGG + Intergenic
1015324776 6:131912697-131912719 TTGAAAAAGATGAATCAAGTGGG - Intergenic
1015390118 6:132672534-132672556 ATGCCAAATTTAAATGAAGTAGG - Intergenic
1015600555 6:134906163-134906185 ATGTAAATATTGAATAAAATTGG + Intergenic
1015941926 6:138461381-138461403 ATGTAAAAGTTGGTTTAACTCGG - Intronic
1016924635 6:149331062-149331084 CTGAAAAAGGAGAATGAAGTTGG - Intronic
1017425521 6:154316645-154316667 ATATAAAAGTTCAATGAAACAGG + Intronic
1017502630 6:155039537-155039559 AGGTAAAAGTTGCCAGAAGTGGG + Intronic
1020494665 7:8834375-8834397 AAGGAATAGTTGAATGAAGAGGG + Intergenic
1021308550 7:19062535-19062557 ATTTAATAGTGGAATTAAGTGGG - Intronic
1022876441 7:34536929-34536951 ATTTAACAGATGAATGATGTTGG - Intergenic
1023685869 7:42734860-42734882 AAGAAAAAATTGAATGAAGTTGG + Intergenic
1027400763 7:77803971-77803993 ATGAAAAAAATAAATGAAGTAGG + Intronic
1027609263 7:80338946-80338968 TTGTAAAAATTCAATGAAATAGG - Intergenic
1027647234 7:80817793-80817815 CTGTAAAAGATGTATAAAGTGGG - Intronic
1027998110 7:85452825-85452847 ATGTATAAACTGAATGTAGTTGG - Intergenic
1029534884 7:101151341-101151363 AAGTAAAAGAAGAAAGAAGTTGG + Intergenic
1030695165 7:112577274-112577296 AAGTAAGAGTTGAATGAAATAGG + Intergenic
1030763694 7:113382581-113382603 CTTCAAAAGTTGAATGAATTGGG + Intergenic
1032678510 7:134156812-134156834 ATGTTAAAGGTGAGTTAAGTTGG + Intronic
1033358224 7:140618342-140618364 ATTTGAAAGTTGAAATAAGTTGG - Intronic
1033487737 7:141807801-141807823 ATATAAAAATTGACTGAACTTGG + Intergenic
1034027220 7:147719141-147719163 AGCTAAAAGTTCAATGAAGGAGG - Intronic
1034877152 7:154734766-154734788 ACGTAAAAGCTGTATGAACTTGG + Intronic
1035552565 8:541051-541073 ATTTTAAAGTTGAGAGAAGTAGG - Intronic
1036395222 8:8364608-8364630 ATGTAAAAGTGGACTGCAGATGG - Intronic
1036539429 8:9690306-9690328 ACGTTAAAATTGAATTAAGTTGG + Intronic
1036743207 8:11384997-11385019 TTGAAAAAGAAGAATGAAGTAGG + Intergenic
1037717294 8:21411230-21411252 ATGTGAAAGTTGATTGAACCAGG - Intergenic
1038131245 8:24733747-24733769 AAGCAAAAGTTCAATCAAGTAGG + Intergenic
1038592310 8:28851060-28851082 AAGTAAAAGCTTAATGAAGAAGG + Intronic
1038757917 8:30359152-30359174 ATGAAAAAGTTCAATTTAGTAGG - Intergenic
1039455642 8:37704137-37704159 ATGTACAAGTGGAAAGAAGGCGG - Intergenic
1040697292 8:50015914-50015936 CTTCAAAAGTTGAATGAATTAGG - Intronic
1041069737 8:54115691-54115713 CTTCAAAAGTTGAATGAATTGGG - Intergenic
1041206536 8:55504559-55504581 AGGTAATTCTTGAATGAAGTAGG + Intronic
1041219518 8:55634687-55634709 CTTCAAAAGTTGAATGAATTGGG - Intergenic
1041306011 8:56461735-56461757 CTGTGAAAGTAGAAGGAAGTGGG - Intergenic
1041403275 8:57467191-57467213 CTGTAATTGTTGAATGAAGATGG - Intergenic
1041620735 8:59965273-59965295 ATGTTAACGGTGTATGAAGTTGG - Intergenic
1042002272 8:64137980-64138002 ATGTAAAAGATAAGTAAAGTAGG - Intergenic
1042756523 8:72219828-72219850 ATGTATAATTTAAATGAAATAGG - Intergenic
1043330452 8:79110848-79110870 CTTCAAAAGTTGAATGAATTGGG - Intergenic
1043663880 8:82783655-82783677 AAGTAATAGTTGAATGATTTAGG + Intergenic
1044108679 8:88244239-88244261 TTATAAAAGTTGTTTGAAGTAGG - Intronic
1044262371 8:90140896-90140918 ATGTAGAAGTTAAATCAAGTAGG - Intergenic
1044526119 8:93253389-93253411 TAGTAAAAGTAGAATGAAGTTGG + Intergenic
1045932801 8:107646881-107646903 TTGAAAAAGAAGAATGAAGTTGG + Intergenic
1046597514 8:116278384-116278406 ATTTAAAAGATTAATGAAGGTGG + Intergenic
1046688500 8:117255226-117255248 ATGTAAAAGTTAACTCAAGATGG + Intergenic
1046760716 8:118017217-118017239 ATGTATAAGGAGAATGAGGTAGG - Intronic
1046992014 8:120468596-120468618 CTTCAAAAGTTGAATGAACTGGG - Intronic
1047530479 8:125669725-125669747 ATGTAAGACTTAAATGAAGGTGG - Intergenic
1048099798 8:131338571-131338593 CTTCAAAAGTTGAATGAATTGGG + Intergenic
1048161545 8:132026169-132026191 ATGTATGAGTTGCATGCAGTGGG + Intronic
1048506661 8:135027765-135027787 CTGTACAAGAAGAATGAAGTGGG - Intergenic
1048808748 8:138265613-138265635 AGGTAAATGTTGAAAGAAGAAGG - Intronic
1049267283 8:141675220-141675242 TTGGAAAAATTGACTGAAGTTGG - Intergenic
1049631444 8:143660440-143660462 AGATAAAAGTTGAAAGAACTTGG - Intergenic
1050000864 9:1075582-1075604 ATTTAAAAGTTAAATGACGCAGG - Intergenic
1050839334 9:10127528-10127550 ATGTATTAGTTTAATGAACTTGG + Intronic
1051899052 9:22018718-22018740 AAGTAAAAGTAGATTGAAATAGG - Intronic
1052171096 9:25397485-25397507 ATGTGAAAGTGGAACGAGGTAGG - Intergenic
1052254519 9:26438779-26438801 ACTTAAAAATTGAATGAAGGAGG - Intergenic
1055662836 9:78523260-78523282 ATGTAAAAAAAAAATGAAGTTGG + Intergenic
1056168296 9:83959063-83959085 ATCTCAAAGTTGAGTGAAGGAGG - Intergenic
1056385811 9:86096029-86096051 TTGTAAAAGTCCATTGAAGTAGG + Intronic
1186615085 X:11177759-11177781 ATGTAAAAGTGGAATGATGGGGG - Intronic
1186877993 X:13835855-13835877 ATGTAAAAGTTGAATGAAGTTGG - Intronic
1188055269 X:25533607-25533629 CTTCAAAAGTTGAATGAATTGGG + Intergenic
1188621240 X:32226725-32226747 CTGAAAAAGCTGAATGAGGTAGG - Intronic
1189223376 X:39392106-39392128 ATTTACATGTTGAATGAGGTTGG - Intergenic
1189416557 X:40819973-40819995 CTTCAAAAGTTGAATGAATTGGG + Intergenic
1189565976 X:42241514-42241536 ATGAAAAAGTTCAATGAAAAAGG + Intergenic
1192862676 X:75094410-75094432 ATAGAAAAGTTGAATTAGGTTGG + Intronic
1193926774 X:87496614-87496636 ATGTAATAGTATTATGAAGTGGG + Intergenic
1194292360 X:92090029-92090051 GTAGAAAAGTTAAATGAAGTAGG - Intronic
1194292361 X:92090079-92090101 GTAGAAAAGTTAAATGAAGTAGG - Intronic
1194489802 X:94531546-94531568 ATGGACAAGTTGACAGAAGTAGG + Intergenic
1194674300 X:96775209-96775231 ATGGAAAAATTAAAGGAAGTGGG - Intronic
1195793283 X:108614409-108614431 ATGTAAAAATTGTTTAAAGTGGG + Intronic
1195866666 X:109439760-109439782 ATGGAAATGAGGAATGAAGTTGG - Intronic
1196136180 X:112212074-112212096 TTGTAAAAATTAAAAGAAGTGGG + Intergenic
1196587673 X:117448406-117448428 ATGTAAAAGTTAACTCAAGATGG + Intergenic
1196653891 X:118197096-118197118 ATGTTAGATTTGAAAGAAGTGGG + Intergenic
1196718059 X:118828486-118828508 AGGTAAATGTTGAATGCTGTGGG - Intergenic
1197015241 X:121617282-121617304 CTTCAAAAGTTGAATGAATTGGG - Intergenic
1197165964 X:123378026-123378048 ATGTAAAAGTGAAGTGAAATAGG - Intronic
1198611560 X:138407056-138407078 ATGTATAAGATGAATAAATTGGG - Intergenic
1199310961 X:146318756-146318778 ATGTATAAATTGACAGAAGTAGG + Intergenic
1199563488 X:149188842-149188864 AGGGAAAGGTTCAATGAAGTGGG + Intergenic
1199723647 X:150561474-150561496 TTGAAAAAGAAGAATGAAGTTGG - Intergenic
1200609868 Y:5314655-5314677 GTAGAAAAGTTAAATGAAGTAGG - Intronic