ID: 1186884774

View in Genome Browser
Species Human (GRCh38)
Location X:13902572-13902594
Sequence GTGGCAGAATAGAAGAGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 208}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186884774_1186884776 -4 Left 1186884774 X:13902572-13902594 CCAGCACTCTTCTATTCTGCCAC 0: 1
1: 0
2: 2
3: 14
4: 208
Right 1186884776 X:13902591-13902613 CCACAACAGCTACCACCTGAAGG 0: 1
1: 0
2: 0
3: 13
4: 116
1186884774_1186884781 29 Left 1186884774 X:13902572-13902594 CCAGCACTCTTCTATTCTGCCAC 0: 1
1: 0
2: 2
3: 14
4: 208
Right 1186884781 X:13902624-13902646 GAGCCAGCTGAAAATCCCTAAGG 0: 1
1: 0
2: 1
3: 9
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186884774 Original CRISPR GTGGCAGAATAGAAGAGTGC TGG (reversed) Intronic
901679934 1:10907066-10907088 GTGGGAGAATGGGAGAGTGGTGG - Intergenic
909166059 1:72226835-72226857 GTTGCAGAATAGAAGTGTAATGG - Intronic
912495088 1:110086352-110086374 GTGGCAGGAGAGACGAATGCTGG - Intergenic
913043937 1:115057404-115057426 GTGGCAGCATAGAGGATTGATGG - Intronic
913500511 1:119468541-119468563 GTGAAAGAAGAGTAGAGTGCTGG - Intergenic
913551683 1:119922817-119922839 GGGGTAAAACAGAAGAGTGCAGG + Intronic
917251270 1:173063910-173063932 ATGGCAGAATAGAAAAATCCAGG + Intergenic
917485602 1:175452152-175452174 GTAGCAGAATAGAGGGGTCCTGG - Intronic
918638611 1:186810636-186810658 GTGGCTGAGTAGAAGAGAGTTGG - Intergenic
920569441 1:207005425-207005447 GAGGAAGAATAGAAGAATGGAGG + Intergenic
920691686 1:208151821-208151843 GAGGCAGAATAAAAGAGTTCAGG - Intronic
922920039 1:229294364-229294386 GAGGAAGACTAGCAGAGTGCAGG + Intronic
923293940 1:232574460-232574482 GTGGCTGAAGAGAAGACAGCTGG - Intergenic
923439830 1:234006727-234006749 GTGGAAGAAGAGATGAGAGCTGG + Intronic
923439916 1:234007472-234007494 GTGGAAGAAGAGATGAGAGCTGG + Intronic
923991072 1:239437428-239437450 GTGGCAGAATTTTAGAGTTCTGG - Intronic
924294509 1:242571622-242571644 TTGGAAGAAATGAAGAGTGCTGG - Intergenic
1063327806 10:5122349-5122371 GGTGCAGAATAGAAGAGGGGTGG - Intronic
1063421890 10:5919063-5919085 CTGGCATAACAGAAGACTGCTGG - Intronic
1064195101 10:13237854-13237876 TGGGAAGAAGAGAAGAGTGCTGG + Intergenic
1067838861 10:49660107-49660129 ATGGGAGAGTAGAAGTGTGCTGG + Intronic
1068398537 10:56496872-56496894 GTGGCAGATGAGCAGAATGCAGG - Intergenic
1070644495 10:78192188-78192210 GTGGGACAAAAGTAGAGTGCAGG + Intergenic
1072304403 10:94093779-94093801 GTCGCAGAGTAGAATAGTGATGG + Intronic
1074535044 10:114322825-114322847 GTGACAGAAGAGAGGAGTGTTGG - Intronic
1074593197 10:114834281-114834303 GTTGCAGAATATTAGAGAGCAGG - Intronic
1075455132 10:122580142-122580164 GAGGCAGAAGAGAAAAGTGCCGG + Intronic
1075458323 10:122599341-122599363 GAGGCAGAAGAGAAAAGTGCTGG + Intronic
1075458832 10:122602376-122602398 GAGGCAGAAGAGAAAACTGCTGG + Intronic
1075459463 10:122606435-122606457 GAGGCAGAAGAGAAAACTGCTGG + Intronic
1075460095 10:122610494-122610516 GAGGCAGAAGAGAAAACTGCTGG + Intronic
1075460727 10:122614553-122614575 GAGGCAGAAGAGAAAACTGCTGG + Intronic
1075461364 10:122618593-122618615 GAGGCAGAAGAGAAAAGTGCTGG + Intronic
1076116491 10:127905393-127905415 GTGGCAGAAGAGATGGATGCAGG + Intergenic
1080663575 11:34316497-34316519 GTAGCAAAAGAGCAGAGTGCAGG - Intronic
1087411343 11:97793335-97793357 ATGGCAGCATAGAAGAAAGCTGG - Intergenic
1087548927 11:99621796-99621818 GTGGGCAAATATAAGAGTGCTGG - Intronic
1091780896 12:3213997-3214019 GTGGCAGAGTGGAAAAGAGCAGG + Intronic
1093621092 12:21289919-21289941 GTTGCAGAATTGAACAGTGTAGG + Intronic
1093840680 12:23895926-23895948 GTGGAAGAAGAGGAGAGTGACGG - Exonic
1095243817 12:39894113-39894135 GTGGCACTATAGGAGAATGCTGG - Intronic
1096118353 12:49069579-49069601 GTGGAGGAATGGAAGAGTGGAGG - Intronic
1098203997 12:68086562-68086584 GGGGCACAAGAGAAGAGGGCAGG - Intergenic
1098256571 12:68622522-68622544 GAGGCAGAATTGCAGAGGGCTGG - Intronic
1099412927 12:82353695-82353717 GTGGCAGATTAGGAGAAAGCAGG - Intronic
1099648402 12:85391463-85391485 GTGGCAGAATAGAGTAGTTTTGG + Intergenic
1101304705 12:103516566-103516588 GTGGCAGAAGAGAGAAGAGCAGG + Intergenic
1102202094 12:111064230-111064252 GTGGCAGGTGAGAAGTGTGCAGG + Intronic
1105372262 13:19812492-19812514 GGGGCAGAATACAAGAGAGTAGG - Intergenic
1105706156 13:22968663-22968685 GTGGCAGGAGAGAAGGGTGAAGG + Intergenic
1106601616 13:31192375-31192397 GTCCCAGAATAGAGGAGAGCTGG - Intergenic
1106845376 13:33732449-33732471 GTGGCAGAAGAAAAGAGAGATGG - Intergenic
1107986056 13:45777073-45777095 GAGGCAGAAAAGAAGAGGGGAGG + Intergenic
1108318428 13:49261796-49261818 AGGGAAGAATAGGAGAGTGCAGG + Intronic
1109828357 13:67753601-67753623 GTGAAAGAAAAGAACAGTGCTGG + Intergenic
1110175032 13:72546090-72546112 GTGGCAGAAAGGAGAAGTGCAGG + Intergenic
1113886770 13:113665151-113665173 GTCGCAGAAAGGAAGAATGCCGG - Intergenic
1114315195 14:21503396-21503418 GTGGCAGAAAAGAAGGGCCCTGG - Exonic
1116520708 14:45843457-45843479 GTGGGGGAATGGAACAGTGCTGG + Intergenic
1119290345 14:73490867-73490889 GGGGCCGAATAGAAGAATGATGG + Intronic
1120075666 14:80155427-80155449 ATGGCAGAATAGAACAGTGAAGG - Intergenic
1120714754 14:87828894-87828916 GTGGCAGAATAGAAGGGACAGGG - Intergenic
1121027643 14:90628320-90628342 GTGGCAGAACAGAAGAGGCCCGG - Intronic
1123099690 14:105788308-105788330 TGGGCAGAATACAAGAGTGAAGG + Intergenic
1124579610 15:30941862-30941884 GTGGCAGAATAACACCGTGCAGG + Exonic
1125101521 15:35918517-35918539 TTTGCAAAATAGAAGAGTTCTGG + Intergenic
1126953318 15:53906865-53906887 GTGGCAGGAGAGAAGAGTGAAGG + Intergenic
1130075474 15:80685508-80685530 GTAGAAGAAAAGAAGAGTGGAGG + Intronic
1130298000 15:82660634-82660656 GAGGCTGAAGAGAAGACTGCTGG - Intronic
1130460625 15:84156419-84156441 GTGGCAGGATAGACGTCTGCGGG + Intergenic
1130910417 15:88266732-88266754 GGGACAGAAGAGAAGAGTGGGGG - Intergenic
1133713475 16:8425013-8425035 TTGGCAGTTTAGAAGAGTTCGGG + Intergenic
1134121451 16:11587182-11587204 GGGGCAGGATAGGAGAGTGGGGG - Intronic
1134744478 16:16577172-16577194 GTGGCAGAATAGAAAAGAATGGG + Intergenic
1143210048 17:5179281-5179303 TTGGCAGAATGGAGAAGTGCTGG + Intergenic
1143286995 17:5797569-5797591 GGGGCTGAATAGAGGAGTACAGG - Intronic
1144857727 17:18279103-18279125 CTGGCTTAATAGAAGAGAGCTGG - Intronic
1147215382 17:38896166-38896188 GTGGCAGAAGTGAAGGGTGGGGG - Intronic
1150168000 17:62963376-62963398 TTGGCAGAATAGAAGGATGGTGG + Intergenic
1150179060 17:63095515-63095537 TTGGCAGAAAAGAGGAGTGCAGG - Intronic
1155253335 18:23971752-23971774 GTGTCAGGATAGAACAGTGTGGG - Intergenic
1156259213 18:35429045-35429067 GTGGCAGAAGAGAGAAGAGCAGG + Intergenic
1158144334 18:54294417-54294439 CTGGCAGAGTGGAAGAGAGCAGG + Exonic
1158198474 18:54913958-54913980 GAGGAAGAATGGAAGAGTGTGGG - Intronic
1161361115 19:3850269-3850291 GTGGGAGAAATGAGGAGTGCTGG + Intronic
1161699644 19:5787719-5787741 GTGGCAGAACAGGAGGGTGAGGG + Intronic
1162565249 19:11442340-11442362 GAGGCAGAACAGAGGAGAGCTGG + Intronic
1162790340 19:13059485-13059507 CTGTCAGAATAGAACAGTCCAGG + Intronic
1168459783 19:56544459-56544481 GTGGCAAAATTGAAGAGTTGCGG + Intronic
928304122 2:30152187-30152209 CTGACAGAATAGAAAATTGCAGG - Intronic
929364352 2:41134793-41134815 GTGGTAGAATATAAGGGTGTAGG - Intergenic
929668088 2:43849368-43849390 GTGGCAGGAGAGAAGAATGAGGG + Intronic
929889734 2:45908900-45908922 CTGCCAGAATAGAGGACTGCGGG - Intronic
930045231 2:47164923-47164945 GTGGAAGAATAGTTGAGTCCAGG - Intronic
930074514 2:47395847-47395869 GTGGGAGAATAGAAAACTCCAGG + Intergenic
931170708 2:59800971-59800993 GTAGCAGAATAGAATAGCCCAGG - Intergenic
931271860 2:60710638-60710660 CTGGCTGAATAGAAAAGAGCTGG + Intergenic
931614976 2:64146208-64146230 GTGGCAGAAGAGAAAACTGAGGG + Intergenic
933223845 2:79722585-79722607 GAGACAGAATAGAAGAGAGGAGG - Intronic
933515430 2:83294710-83294732 GTGGTAGAATAGGAAAGTCCAGG - Intergenic
933848031 2:86341196-86341218 GAAGCAGAATATAAGAGTGATGG + Intergenic
934997132 2:98974181-98974203 ATGGCAGAATAGAAGATTCCTGG - Intergenic
937075846 2:119105932-119105954 GTGGGAGAATAGATGAGGGGAGG + Intergenic
937155188 2:119714039-119714061 GTGGCTGAACAGATGAGTGGTGG + Intergenic
937341289 2:121092464-121092486 GTAGCAGAACATAGGAGTGCTGG - Intergenic
937365451 2:121257689-121257711 GTGGCAGAGTTGAATAGTGTGGG - Intronic
938062343 2:128263240-128263262 CTGGCAGGATAGAAGGGGGCAGG + Intronic
939096237 2:137836727-137836749 GTGCCAGAAGAGAAGGGTCCTGG + Intergenic
940975125 2:159934298-159934320 GTGACACAAAAGAAGAATGCAGG + Intronic
943754830 2:191546933-191546955 GTGGCATTTTTGAAGAGTGCAGG + Intergenic
944366730 2:198929554-198929576 GTGACTGAATAAATGAGTGCTGG - Intergenic
948623051 2:239248809-239248831 GAGGCAGAACAGCAGAGTGGGGG - Intronic
1169993163 20:11526061-11526083 GTGACAGAATAGATGAGGGCTGG + Intergenic
1170760929 20:19251041-19251063 GTACCAGAATGGAAGAGTGGTGG - Intronic
1172310406 20:33913598-33913620 GTGGGAGAGTAGAAGAGGCCAGG - Intergenic
1172468407 20:35173955-35173977 GTAGCAGAATGGCTGAGTGCTGG + Intronic
1172930641 20:38583982-38584004 GCAGCAGAATAGAAAACTGCAGG - Intronic
1173129406 20:40375109-40375131 GTGGTAGAATAGAGGAGTTGTGG - Intergenic
1175673636 20:60928609-60928631 GAGCCAGAAGAGAAGAGTCCGGG - Intergenic
1177418573 21:20826394-20826416 GTAGCAGCAAAGAAAAGTGCAGG + Intergenic
1177941104 21:27412170-27412192 ATGTAAGAGTAGAAGAGTGCCGG - Intergenic
1179112415 21:38458812-38458834 GTTGGAGAAGAGAAGAGAGCAGG - Intronic
1179387039 21:40953420-40953442 GTGGCAGGAGAGAGAAGTGCAGG + Intergenic
1179964055 21:44790611-44790633 GTGGCAAGAAAGAAGAGTGAAGG - Intronic
1183949204 22:41343359-41343381 GAAGCAGAATTGAAGAGTGATGG - Intronic
950487292 3:13281274-13281296 GTGGCAGGACTGAAGAGTGAAGG + Intergenic
952840957 3:37644968-37644990 GTGGCACGTTATAAGAGTGCAGG - Intronic
952849678 3:37717569-37717591 GTGGCAGGAGAGAAGGGGGCTGG + Intronic
954022207 3:47752119-47752141 GTGGCAGAATAAAATGGTACTGG + Intronic
956039802 3:65133879-65133901 GTGGAAGAATGGAACAGGGCTGG - Intergenic
956466258 3:69523458-69523480 ATGTCAGAATAGAAGAGGGAGGG - Intronic
956762231 3:72454101-72454123 GTGGCAGCAAAAAAGAATGCAGG + Intergenic
959864132 3:111246736-111246758 GGGGCAGGAGAGAGGAGTGCAGG - Intronic
961483841 3:127203045-127203067 TTGGCAGGAAAGAAGACTGCTGG - Intergenic
964672037 3:159237392-159237414 GTGACAGAAGAAAAGACTGCGGG + Intronic
966059360 3:175735603-175735625 GTGGCAGGAAAAAAGAGAGCAGG + Intronic
967155298 3:186686142-186686164 GTTGTAGAAAACAAGAGTGCAGG + Intergenic
967739616 3:192990716-192990738 GTGGCAGCAAAGGGGAGTGCAGG + Intergenic
967927420 3:194662406-194662428 GTGGTATAATACAAGGGTGCTGG - Intronic
968508515 4:983745-983767 GAGGAAGAAGTGAAGAGTGCGGG - Intronic
969355309 4:6621508-6621530 GTGACAGAAGAGGAGAGGGCTGG - Exonic
969621961 4:8283157-8283179 GTGGCAGAATGAATGAGTGAGGG + Intronic
972192815 4:36615499-36615521 GTGGCAGGATAGAGGAGAGAAGG + Intergenic
972245980 4:37245408-37245430 GTGTCCTAATAGAAGTGTGCAGG - Intronic
972378464 4:38495943-38495965 GTGGAATAATAGAATAGAGCAGG + Intergenic
976933744 4:90602741-90602763 GGGACAATATAGAAGAGTGCAGG + Intronic
977483637 4:97613266-97613288 TTGGCAGTATTGAAGAGTACTGG + Intronic
978380866 4:108127137-108127159 TTGGCAGAAAAAAACAGTGCAGG + Intronic
980082718 4:128361612-128361634 GTGGCACAATGCAAGAGTGCTGG + Intergenic
980620873 4:135301966-135301988 ATGGCAGAATAGGAGAGAGTTGG + Intergenic
980882944 4:138732041-138732063 GTGGCAGCATGGCAGAGTTCTGG - Intergenic
980991900 4:139745373-139745395 GTGTCAGATTAGAACAGGGCTGG + Intronic
982210663 4:153032580-153032602 CTGGCTTAATAGAAGACTGCTGG + Intergenic
984050743 4:174861944-174861966 GTGGCAGAAGAGAATGGAGCCGG + Intronic
984268200 4:177519668-177519690 GTTGCAGAATAGAAAATTCCAGG + Intergenic
984924065 4:184791333-184791355 CTGGCTGAGCAGAAGAGTGCAGG + Intronic
986980902 5:13447201-13447223 GTGGCAGAATAGGAAAGTATTGG - Intergenic
989791048 5:45402296-45402318 CAGGCAGAATTGCAGAGTGCTGG + Intronic
993619668 5:90153100-90153122 TTGGCAGAATTGAAGAGTAAAGG - Intergenic
994144663 5:96381132-96381154 CTGGCTTAATAGAAGAATGCTGG - Intergenic
994934307 5:106234198-106234220 GTGGCTGATTAGAAATGTGCGGG + Intergenic
995714638 5:115070089-115070111 CTGGGAGAATAGAAGAGTTTGGG + Intergenic
996353100 5:122567457-122567479 GTGTCAGAAAAGAAGTGTGGTGG - Intergenic
997373996 5:133384030-133384052 TTGGAAGAAAAGAAGACTGCTGG + Intronic
997630001 5:135360258-135360280 GTGGTAAAAAAGAAGAGGGCAGG - Intronic
999330911 5:150672686-150672708 GTGGGAGAAATGAAGAGTGAAGG + Intronic
1000418524 5:161010372-161010394 GAGAGAGAATATAAGAGTGCTGG - Intergenic
1000605651 5:163324850-163324872 GTTGCATAATAGAATGGTGCAGG - Intergenic
1001295776 5:170497890-170497912 GTGGCAGCGCAGAAGCGTGCAGG + Intronic
1002465531 5:179406435-179406457 GTGGGAGAAGAGCAGGGTGCAGG - Intergenic
1002939153 6:1700714-1700736 GTGGCAAGAAAGAAGACTGCAGG + Intronic
1005591823 6:27336737-27336759 GTGGCACAGTAGAAGCCTGCTGG - Intergenic
1007894365 6:45336105-45336127 CTGGGAGAATAGAAGAATTCTGG - Intronic
1009477641 6:64114385-64114407 GTGGTAGAGTAGAAGACTCCAGG + Intronic
1009974206 6:70655572-70655594 GTGGCAGAAGAGCTGAGTGGTGG + Intergenic
1010136541 6:72560950-72560972 GTCGCAGAATAGAAAATTCCAGG + Intergenic
1010590077 6:77701969-77701991 AAGGCAGAAAAGAAGAGTGAGGG - Intronic
1011237524 6:85233720-85233742 GTGGCAGAAGAGAGGCATGCAGG - Intergenic
1012603652 6:101130752-101130774 GTGGTAGAATATAAGACTCCAGG - Intergenic
1014930067 6:127325238-127325260 TTGGCAGTTTTGAAGAGTGCTGG - Intronic
1017533633 6:155323292-155323314 GGGGAAGGAAAGAAGAGTGCTGG + Intergenic
1020250682 7:6465987-6466009 GTGCCAGATTAGAAGAGTGCTGG + Intronic
1020422475 7:8024541-8024563 TAGGAAGAATTGAAGAGTGCTGG + Intronic
1021368367 7:19810071-19810093 GGGGAAGAATGGAAGAATGCAGG + Intergenic
1021686315 7:23190318-23190340 TTGGCTTAATAGAAGACTGCTGG - Intronic
1022216863 7:28271731-28271753 GTGGGAAAATTGAAGAGAGCAGG + Intergenic
1022647403 7:32244179-32244201 ATGGTAGAAAAGAAGAGGGCGGG + Intronic
1024534883 7:50421893-50421915 ATGCTAGAATAGAAGAGAGCTGG - Intergenic
1025153711 7:56584421-56584443 TTTGCATAATAGAAGAGTGGTGG + Intergenic
1025812727 7:64885380-64885402 GGGGCAGAAGAGAGGAGGGCTGG - Intronic
1027152087 7:75739666-75739688 GGGGCAGAATGGAGAAGTGCAGG - Intergenic
1028095819 7:86759114-86759136 GGGGCAGAATAGAGGAGGCCAGG - Intronic
1028464114 7:91130210-91130232 GTGGCTGGATAGAAGAGAGTTGG - Intronic
1028905729 7:96152159-96152181 GTGGCTGAAAATAAGATTGCTGG + Intronic
1031716420 7:125114142-125114164 GAGGCAGAAAAGAAGAGAGGAGG + Intergenic
1034830222 7:154302534-154302556 ATGGCAGAGTAGATGAGTGAGGG + Intronic
1037359043 8:18053953-18053975 GTGGCAGAAGGCAAGAGGGCGGG + Intergenic
1037403547 8:18517985-18518007 GTGGCAGGAAAGAGAAGTGCTGG + Intergenic
1037575077 8:20194826-20194848 GTTACAGAATGGAAAAGTGCAGG + Intergenic
1039416634 8:37400559-37400581 GTGGCAGAAGACAAGAGTGCGGG - Intergenic
1043786932 8:84415136-84415158 GAGGCAGAATATTAGAGTGAAGG - Intronic
1044175979 8:89123127-89123149 GTGGCCGAATAGCAGAGAGTGGG - Intergenic
1048985417 8:139732296-139732318 GTGGCAGCCTTGAAGAGTGAAGG - Intronic
1049986246 9:954431-954453 GTGGCAGAGTTCAAGAGAGCAGG + Intronic
1050291122 9:4156173-4156195 GTGAGAGAATGGAAGAGTGAAGG - Intronic
1051760012 9:20452368-20452390 GTGGCAGGAGAGAAAAATGCAGG - Intronic
1052715538 9:32111957-32111979 GTGGCAGGAAAGGAGAGTTCTGG - Intergenic
1052864678 9:33457731-33457753 CTGGGAGAATAGAGGAGAGCTGG + Intergenic
1053113496 9:35482031-35482053 TTGACAGAATTCAAGAGTGCAGG + Intergenic
1186884774 X:13902572-13902594 GTGGCAGAATAGAAGAGTGCTGG - Intronic
1187254035 X:17625210-17625232 GTGGCTTAATAGAAGACTGCTGG + Intronic
1189498233 X:41529155-41529177 GAAGCAGGAGAGAAGAGTGCAGG + Intronic
1191056671 X:56248907-56248929 GTGACAGAAAAGGAGAGTGAGGG - Intronic
1194106586 X:89776487-89776509 GTGGCAGAAAACAAAATTGCAGG - Intergenic
1194935374 X:99941244-99941266 GTGGTGGAATATAAGAGTACTGG - Intergenic
1195165899 X:102220157-102220179 GTGGCAGAATAGGATCGTGAAGG + Intronic
1195192960 X:102466934-102466956 GTGGCAGAATAGGATCGTGAAGG - Intronic
1195364191 X:104111936-104111958 CTGACAGAATAGAGGAGTGCTGG + Intronic
1196893163 X:120309559-120309581 AGGGCAGAGTGGAAGAGTGCTGG - Intronic
1197891326 X:131273412-131273434 ATGGCAGAATAAGAGAGTGCAGG - Intergenic
1198421722 X:136475129-136475151 TTGGCACAATAGAAAAGGGCTGG + Intergenic
1199881584 X:151977555-151977577 GTGGCAGAACAGAATAATGAAGG + Intergenic
1200458550 Y:3424347-3424369 GTGGCAGAAAACAAAATTGCAGG - Intergenic
1202378622 Y:24258761-24258783 GTGGCAGGATAGACGTCTGCGGG - Intergenic
1202492160 Y:25411360-25411382 GTGGCAGGATAGACGTCTGCGGG + Intergenic