ID: 1186888365

View in Genome Browser
Species Human (GRCh38)
Location X:13937615-13937637
Sequence TTCAGGAGTGCTGCGGAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 105}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186888359_1186888365 6 Left 1186888359 X:13937586-13937608 CCCTTTCCCAAGCACAGCTGTCA 0: 1
1: 0
2: 2
3: 24
4: 295
Right 1186888365 X:13937615-13937637 TTCAGGAGTGCTGCGGAATGAGG 0: 1
1: 0
2: 1
3: 5
4: 105
1186888361_1186888365 0 Left 1186888361 X:13937592-13937614 CCCAAGCACAGCTGTCACACGTT 0: 1
1: 0
2: 0
3: 6
4: 95
Right 1186888365 X:13937615-13937637 TTCAGGAGTGCTGCGGAATGAGG 0: 1
1: 0
2: 1
3: 5
4: 105
1186888360_1186888365 5 Left 1186888360 X:13937587-13937609 CCTTTCCCAAGCACAGCTGTCAC 0: 1
1: 0
2: 2
3: 29
4: 265
Right 1186888365 X:13937615-13937637 TTCAGGAGTGCTGCGGAATGAGG 0: 1
1: 0
2: 1
3: 5
4: 105
1186888362_1186888365 -1 Left 1186888362 X:13937593-13937615 CCAAGCACAGCTGTCACACGTTT 0: 1
1: 0
2: 0
3: 7
4: 97
Right 1186888365 X:13937615-13937637 TTCAGGAGTGCTGCGGAATGAGG 0: 1
1: 0
2: 1
3: 5
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186888365 Original CRISPR TTCAGGAGTGCTGCGGAATG AGG Intronic
901443956 1:9295620-9295642 TTCACCAGAGCTGGGGAATGGGG + Intronic
902325252 1:15695908-15695930 TTCAGGAGGGCTGAGGTAGGAGG - Intronic
905172377 1:36116748-36116770 TCCAGAAGTGCTGTGGGATGGGG + Intronic
905542802 1:38773728-38773750 TTCTGGGGTGGTGAGGAATGTGG - Intergenic
907491728 1:54812917-54812939 CTCAGGAGTGCTGAGGAGGGTGG + Intronic
911253501 1:95607527-95607549 ACCAGGAGAGCTGAGGAATGTGG - Intergenic
917197940 1:172486079-172486101 CTCAGGAGTGCTGCACAATCTGG + Intergenic
918650366 1:186955337-186955359 TTCAGGATTTCTGCAAAATGAGG - Intronic
920193148 1:204207786-204207808 TTCAGGGGTGATGAGGTATGAGG - Intronic
920339498 1:205267144-205267166 TTCAGGAGTGATTAGGGATGGGG + Intronic
921306136 1:213798719-213798741 TTCAGCAGTTCTGCAGAAAGAGG + Intergenic
922940125 1:229456163-229456185 TTCAGGAGTGGTACACAATGTGG + Intronic
1068145975 10:53071297-53071319 CTCTGGAGTGCTGGGGGATGTGG + Intergenic
1071120081 10:82266795-82266817 TTCATGACTGCTGGGAAATGAGG - Intronic
1072186663 10:93046551-93046573 TACAGAAGAGCTGAGGAATGAGG + Intronic
1073710332 10:106029540-106029562 GTCATGAGTGCGGAGGAATGTGG + Intergenic
1074253619 10:111778475-111778497 TTAAGGAGTGCTGAGAGATGAGG - Intergenic
1077050343 11:563562-563584 TCCAGGAGTTCTGCGTCATGGGG - Exonic
1078581536 11:12542945-12542967 CTCAGGTGTGTTGGGGAATGGGG - Intergenic
1083389811 11:62339927-62339949 TTAAAGAGTGCTGCGTAAAGGGG - Intronic
1091805429 12:3352635-3352657 TTGAGGAGAGCTGCAGAAGGGGG - Intergenic
1095853171 12:46831947-46831969 TCCAGGAGGGCTGGGGTATGGGG - Intronic
1096619028 12:52850904-52850926 TTCAGGCGTGCTGCCGGTTGGGG - Intergenic
1099465609 12:82983555-82983577 TTCAGAAGTGCTCAGGAATTGGG + Intronic
1102515430 12:113443042-113443064 TTAAGGAGTGATGGGGACTGAGG + Intergenic
1104637844 12:130449186-130449208 TTCACGAGTGCTAAGAAATGGGG + Intronic
1118790564 14:69088121-69088143 TTAAGGAGTGGTGGGGATTGTGG - Intronic
1119208063 14:72809497-72809519 CTCAGGAGTGCTGGTGGATGGGG - Intronic
1122503939 14:102219685-102219707 TTCCTGAGTGCTGCAGCATGGGG + Intronic
1124211610 15:27769371-27769393 TTCCGGATTGCTGGGAAATGGGG + Intronic
1129484686 15:75858675-75858697 TCCAGGAGTGCTGGGGAGAGAGG - Intronic
1131069763 15:89458809-89458831 GTCAGGAGTGGTGAGGCATGAGG - Intergenic
1132284101 15:100647679-100647701 TTGAGGAGTGCAGCAGAAGGGGG - Intronic
1133136212 16:3713971-3713993 TGCAGGAGTGATGGTGAATGAGG - Intronic
1136605038 16:31327892-31327914 TTCAGGAGGGCTGGCGATTGGGG + Intronic
1138114827 16:54352009-54352031 TCCAGGAGTGGTTCAGAATGAGG + Intergenic
1140708281 16:77651923-77651945 TTTGGGGGTGCTGAGGAATGTGG + Intergenic
1144262723 17:13538592-13538614 TTCAGGAGTGGTCAGAAATGTGG - Intronic
1147370695 17:39990700-39990722 GTCAGGAGCGCTGGGGAATCAGG - Intronic
1147451673 17:40509639-40509661 TCCAAAAGTACTGCGGAATGTGG - Intergenic
1147861371 17:43525797-43525819 TCCAGGAGTGTTTCTGAATGGGG - Intronic
1149368116 17:55965876-55965898 TACAGCAGTGCTGCGGCCTGGGG + Intergenic
1152350749 17:79782696-79782718 TGCAGGAGTTCTGCTGACTGAGG + Intronic
1155343068 18:24832033-24832055 TCCAGGTCGGCTGCGGAATGTGG + Intergenic
1158392346 18:57053695-57053717 TTCTGGGGTGCTTCAGAATGTGG - Intergenic
1160810739 19:1011975-1011997 TGCAGGCTTCCTGCGGAATGTGG - Exonic
1166132862 19:40756942-40756964 CTCAGGAGGGCGGTGGAATGTGG + Intronic
1166225955 19:41395463-41395485 TTCAGGAGTTCTGCTGTAAGAGG - Intronic
927133474 2:20080087-20080109 TTCGGGAGTACTGTGGAAGGTGG - Intergenic
928253662 2:29703506-29703528 TTCAGCAGTTCTGGGAAATGAGG - Intronic
928455087 2:31413441-31413463 TTGGGAAGTGCTGGGGAATGGGG - Intronic
929947026 2:46379467-46379489 TACAGGAGTGCTGAGGAGGGAGG - Intronic
932229167 2:70068285-70068307 CTCTGGAGTGCTGAGGAATGGGG + Intergenic
935093378 2:99918426-99918448 TTCTGGAGTGCTGCAGAACTAGG - Intronic
938080832 2:128369244-128369266 TGCAGGACTGCAGCTGAATGTGG + Intergenic
938108246 2:128547676-128547698 TTCTGGAGTGAAGCGGATTGTGG + Intergenic
941796061 2:169599816-169599838 TTAAGCAGTGCTTAGGAATGGGG - Intronic
948118052 2:235508405-235508427 TGCAGGAGAGCTGCGAACTGCGG - Intronic
948571586 2:238921014-238921036 TGCAGGAGTGCTGGGGGCTGGGG + Intergenic
1169514440 20:6300444-6300466 TTCAGGAGTTCTCCTGACTGGGG - Intergenic
1173814159 20:45974336-45974358 TTCTGTAGGGCTGAGGAATGGGG - Intergenic
1176753783 21:10710731-10710753 TTGTGGAGTGCAGTGGAATGGGG - Intergenic
1177809359 21:25908903-25908925 TTCAGGAGTTCAGGGGTATGGGG + Intronic
953386038 3:42506117-42506139 AGCAGGAGTCCTGGGGAATGGGG + Intronic
953698830 3:45180567-45180589 CTCAGGAGTGCTGCTGATTAAGG + Intergenic
957954111 3:87161481-87161503 TTCAGGAGAACTGAGGGATGAGG - Intergenic
959202570 3:103267318-103267340 TTCAGGAGTACTGAGGTAGGAGG + Intergenic
960997741 3:123350932-123350954 TTCAGGAATGCTGAGGCCTGGGG + Intronic
961869787 3:129978929-129978951 TTCAGGTGGGGTGGGGAATGGGG + Intergenic
962979001 3:140470911-140470933 TTCAGGAGTGCTGCTGAGAGAGG + Intronic
975589379 4:75985245-75985267 TTCAGGATTGTAGTGGAATGAGG - Intronic
978373810 4:108054258-108054280 ATCAGGTGCGCTGCGGGATGTGG + Intronic
979782769 4:124675262-124675284 TTCACCAGTACTGCGTAATGCGG - Intronic
981720083 4:147792814-147792836 TGTAGGAGTCCTGGGGAATGTGG + Intronic
982287772 4:153753206-153753228 CTCAGGAGGGCTGTGGATTGCGG + Intronic
982315021 4:154023551-154023573 CTCAGCAATGATGCGGAATGGGG + Intergenic
988206015 5:28135853-28135875 TGCAGCAGTGATGCAGAATGAGG - Intergenic
988661503 5:33274896-33274918 TTCAGGAGTGCTCCAGAAGAAGG - Intergenic
989172659 5:38488199-38488221 TTCATGATTGCTGGTGAATGAGG - Intronic
990109161 5:52302625-52302647 TTGAGGAGTGCTGCTGAAGAGGG + Intergenic
998742318 5:145218236-145218258 GTCAGGAGTGCTGCGGAGTGTGG + Intergenic
998957692 5:147454002-147454024 TTCGCGAGTGCTGCGGAGTCAGG + Intronic
999283152 5:150378148-150378170 TTGAGGAATGCTGGGGGATGGGG + Intronic
1006258404 6:32849094-32849116 TTCAGGTATGCTGCTGAAAGTGG - Exonic
1017846484 6:158262809-158262831 TTCAGGAGTGCAGCCGGTTGTGG + Intronic
1018953218 6:168392139-168392161 TACAGGTGTGCTGGGGGATGGGG - Intergenic
1019664757 7:2246283-2246305 TTCAGGAGACCTGCAGAAGGAGG + Intronic
1021234458 7:18125154-18125176 TGCAGCAGTCCTGGGGAATGAGG + Intronic
1021958884 7:25852865-25852887 TTCAGGAGAGCTGGGGACAGCGG + Intergenic
1028859680 7:95634778-95634800 TTCTGAAGTACTGGGGAATGGGG - Intergenic
1034547025 7:151795680-151795702 TTCAGGCCTGCTGCGGATTGGGG - Intronic
1034947785 7:155274591-155274613 GGCAGGAGGGCTGGGGAATGTGG + Intergenic
1035551483 8:530908-530930 CTCAGCAGTGCTGCGGATGGAGG - Intronic
1036752635 8:11453014-11453036 GTCAGGAGTGCAGGGGAATGGGG - Intronic
1045405336 8:101860736-101860758 TGAGGGAGAGCTGCGGAATGGGG + Intronic
1047846597 8:128812865-128812887 TTCAGGAGTGCTCCTCAATCTGG - Intergenic
1051754838 9:20387944-20387966 TTCAGGAGGGCAGCGGAGAGTGG + Intronic
1056777969 9:89527699-89527721 TCCATGGGTGCTGAGGAATGGGG - Intergenic
1056848667 9:90062295-90062317 TTCAGGGGTCCTGCTGACTGTGG + Intergenic
1059439724 9:114300258-114300280 TTCTGGAGTACTGGGGGATGAGG - Intronic
1061276027 9:129569724-129569746 TCCATGAGTGCTGAGGAAGGAGG - Intergenic
1186888365 X:13937615-13937637 TTCAGGAGTGCTGCGGAATGAGG + Intronic
1189197865 X:39166891-39166913 TGCTGGAGTGCTGAGAAATGAGG + Intergenic
1190597259 X:52062182-52062204 TGCAGGAGGGCTGCGGAGGGGGG - Intronic
1190611565 X:52191891-52191913 TGCAGGAGGGCTGCGGAGGGGGG + Intronic
1192215265 X:69153572-69153594 TCCAGGCCTGCTGAGGAATGTGG - Intergenic
1195176201 X:102317618-102317640 TGGAGGAGAGCTTCGGAATGGGG + Intronic
1195182663 X:102369475-102369497 TGGAGGAGAGCTTCGGAATGGGG - Intronic
1198103555 X:133441726-133441748 TTCAGGAGTGCTGAGCAGTGGGG - Intergenic
1198809000 X:140516329-140516351 TTCAGGAATCCTGCTGAATTAGG + Intergenic
1199433621 X:147788179-147788201 TTTAGGAGGGCTGTGGAGTGTGG - Intergenic
1201514505 Y:14804661-14804683 TTCAGGAGTGCTGCTCTATAGGG - Intronic