ID: 1186895166

View in Genome Browser
Species Human (GRCh38)
Location X:13998114-13998136
Sequence CATTCTGACTGGAGTGCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186895163_1186895166 23 Left 1186895163 X:13998068-13998090 CCATTTTTGCTTTTTTTTTTTTT 0: 21
1: 500
2: 25608
3: 34519
4: 77966
Right 1186895166 X:13998114-13998136 CATTCTGACTGGAGTGCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186895166 Original CRISPR CATTCTGACTGGAGTGCAGT GGG Intergenic
No off target data available for this crispr