ID: 1186895544

View in Genome Browser
Species Human (GRCh38)
Location X:14001433-14001455
Sequence ATAATCAATTTGTCCAAGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186895543_1186895544 15 Left 1186895543 X:14001395-14001417 CCATACTCAAATTTCTTCAATGA No data
Right 1186895544 X:14001433-14001455 ATAATCAATTTGTCCAAGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186895544 Original CRISPR ATAATCAATTTGTCCAAGTT AGG Intergenic
No off target data available for this crispr