ID: 1186897638

View in Genome Browser
Species Human (GRCh38)
Location X:14020359-14020381
Sequence CTTTGGGGAAGAAGCGCAGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 233}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186897632_1186897638 30 Left 1186897632 X:14020306-14020328 CCACATGATGGTCATAGAAGGAC 0: 2
1: 1
2: 1
3: 5
4: 82
Right 1186897638 X:14020359-14020381 CTTTGGGGAAGAAGCGCAGAAGG 0: 1
1: 0
2: 1
3: 19
4: 233
1186897634_1186897638 -6 Left 1186897634 X:14020342-14020364 CCTCATTATCGTAAGAGCTTTGG 0: 1
1: 0
2: 1
3: 4
4: 64
Right 1186897638 X:14020359-14020381 CTTTGGGGAAGAAGCGCAGAAGG 0: 1
1: 0
2: 1
3: 19
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186897638 Original CRISPR CTTTGGGGAAGAAGCGCAGA AGG Exonic
901775746 1:11559567-11559589 CTCTAGGGAAGAAGCCCAGGGGG - Intergenic
902375370 1:16027800-16027822 CTCTGGGGAAGGAGGGCAGTGGG - Exonic
902380334 1:16049597-16049619 CTCTGGGGAAGGAGGGCAGTGGG - Exonic
902439184 1:16418159-16418181 CTGTGGGGGAGAAGAGGAGAGGG - Intronic
904044386 1:27601391-27601413 CTTTGGGGCAGATGCCCAGGTGG - Intronic
905878236 1:41447188-41447210 TTCTGGGGAAGGAGAGCAGAAGG - Intergenic
906666315 1:47624596-47624618 CTATGGGGAAGGAGAGCAAAGGG - Intergenic
907714657 1:56915836-56915858 ATTTGGGGAATGAGAGCAGAGGG + Intronic
907989789 1:59568617-59568639 CTTTGGGGAAGACGCACACACGG - Intronic
908881710 1:68740118-68740140 CTTTGGGGGAGGAGCCAAGATGG - Intergenic
909748946 1:79134895-79134917 CCTTTGGGAAGCAGAGCAGAAGG + Intergenic
910425579 1:87117305-87117327 CTAAGGGGAAGAAGTGCAGGTGG - Intronic
910640584 1:89457185-89457207 CTTTGGGTGAGTAGGGCAGATGG + Intergenic
912233401 1:107821892-107821914 CTTAGGGGAAGAAGTACAGGTGG + Intronic
913040977 1:115022823-115022845 CTTTTGGGAGTAAGCTCAGAGGG + Intergenic
913361579 1:117986839-117986861 CTTCAGGGAAGAAGAGCAGAGGG - Intronic
914000910 1:143693458-143693480 CTTCAGGGAAGAAGGGCAGGGGG - Intergenic
914377156 1:147081417-147081439 CTTCAGGGAAGAAGCGCAGGGGG - Intergenic
914513765 1:148356065-148356087 CTTTGGGGAAGAAGGGCAGGGGG - Intergenic
915455134 1:156035568-156035590 CTTTGAGGAAGGAGAGGAGAGGG - Exonic
916123169 1:161547338-161547360 TTTGGGGGAAGAAGGGCATAAGG - Intronic
916133061 1:161628696-161628718 TTTGGGGGAAGAAGGGCATAAGG - Intronic
916193732 1:162203841-162203863 CTTTGGTCAAGAAGGCCAGATGG + Intronic
919825561 1:201500693-201500715 CTGTGGGGAAGAGGCTCAGCTGG + Intronic
919919769 1:202160987-202161009 CTGTGGGGCAGAAGCAGAGAAGG - Exonic
920039260 1:203085266-203085288 CAGTGGGGAGGAAGTGCAGAAGG - Intronic
921764869 1:218959708-218959730 TTTTGGTGAAGAAGAGTAGATGG + Intergenic
924458655 1:244238656-244238678 CTTTGGGGAGCAAGTGCAGCAGG + Intergenic
1063993635 10:11594960-11594982 CTATGGAGAAGCAGCGCACAGGG + Intronic
1064191881 10:13213622-13213644 CTTTGGGGGAGAATAGCTGAAGG - Intergenic
1064590907 10:16890097-16890119 ATATTGGGCAGAAGCGCAGATGG - Intronic
1064644319 10:17445523-17445545 CTTTGGAAAAGAAAGGCAGACGG - Intronic
1066486386 10:35849342-35849364 CTCTGGGGGAGAAGCTCACAAGG - Intergenic
1067012677 10:42729108-42729130 CTTTGGGAAAGGAGCTAAGATGG + Intergenic
1067191052 10:44068727-44068749 CTTTAGGGAAGAAGGACACAGGG + Intergenic
1067307360 10:45076891-45076913 CTCTGGGGGAGAAGCTCACAAGG - Intergenic
1067310912 10:45112760-45112782 CTTTGGGAAAGGAGCTAAGATGG - Intergenic
1068550713 10:58404837-58404859 CCTTGGGAAAGAAAGGCAGAAGG - Intergenic
1068913850 10:62407234-62407256 CTATGGGGAAGCAGGTCAGAGGG - Intronic
1070412542 10:76156197-76156219 CTTGGGAGAAGCAGCTCAGATGG - Intronic
1071966680 10:90858519-90858541 CTTATGGGAAGAAGCGAAGATGG + Intergenic
1072788874 10:98303269-98303291 CTCTGGGGAACAAGGGCACAGGG + Intergenic
1073207969 10:101778688-101778710 CTCTGGGGGAGAGGAGCAGATGG + Intronic
1073900792 10:108218008-108218030 CTTTGCAGGAGAAGAGCAGAGGG + Intergenic
1074729107 10:116349524-116349546 CTTTGAAGAAAAAGCACAGAGGG - Intronic
1075006705 10:118835863-118835885 CTTTGGGGAAGAGGTGGGGAGGG - Intergenic
1076739804 10:132477594-132477616 CTATGTGGAAGAAGCTCGGACGG - Intergenic
1077868358 11:6241116-6241138 AGTTGGGGAAGTAGAGCAGAGGG + Intronic
1077920159 11:6635988-6636010 CTTTGGGGCAGAATGGGAGAGGG - Intronic
1078337108 11:10473365-10473387 CTTTAGGGAGGAAGGGCAGCTGG + Intronic
1080735064 11:35005638-35005660 CTTTGGAGAAGAAATGCATATGG + Intronic
1081650767 11:44822701-44822723 CTTTGGGGAAGGACAGCTGAAGG - Intronic
1083593875 11:63909948-63909970 CTCTGGGGAGGAGGGGCAGAGGG - Exonic
1085829934 11:79888822-79888844 CTTTGGGAAAGAAGATGAGAAGG + Intergenic
1086341729 11:85854650-85854672 CATTGTGGAAGGAGCGCAGCGGG + Intergenic
1087081455 11:94174718-94174740 CTTAGGGGATTAAGTGCAGATGG - Intronic
1088632342 11:111785953-111785975 CTTTGGTGGAGAAGCCCATATGG + Intronic
1088827327 11:113506925-113506947 CCTTGGGGAATGAGGGCAGAAGG + Intergenic
1090002439 11:122973865-122973887 CTTTGGGGGAGAAGTGGGGAAGG - Intergenic
1090534534 11:127626141-127626163 CTTGGAGGAAGAGACGCAGAAGG + Intergenic
1091996675 12:4999253-4999275 CTCTGGGGAAGAAGCACAGGTGG + Intergenic
1093693102 12:22129343-22129365 CTTTGGGGCACAAGAGTAGATGG + Intronic
1094056427 12:26273773-26273795 ATTTGGGGAAGAAGAGGAAATGG - Intronic
1094455398 12:30627013-30627035 GTTTGAGGAAGAAGCACAAAGGG - Intergenic
1096742036 12:53700702-53700724 GTTTGTGGAGGAAGCTCAGAAGG + Intergenic
1096749070 12:53747414-53747436 CTTTGGGGGAGAAACCCAGTGGG + Intergenic
1096876666 12:54634977-54634999 GTTTGGGGAAGAAGGGGAGGAGG - Intergenic
1101154973 12:101918669-101918691 GTTTGGGGTAGAAGAGCAGTGGG + Intronic
1101323955 12:103698284-103698306 CTGTGGGGAAGGAGAGGAGAAGG - Intronic
1103251774 12:119506139-119506161 CTCTGGGTAAGAAGGGCAGAAGG - Intronic
1103951833 12:124555590-124555612 CTCTGCTGAAGAAACGCAGAGGG + Intronic
1104843885 12:131837197-131837219 CTCTGAGGAAGGAGCCCAGAGGG + Intronic
1105718959 13:23095006-23095028 CTTCTGGGAAGAAGTACAGAAGG - Intergenic
1105871711 13:24511439-24511461 ATTTGGGGAAGAAGCTGGGAAGG - Intronic
1106286657 13:28323855-28323877 CTTTGGGGAAGGAGGGAACATGG + Intronic
1106801031 13:33255862-33255884 GTTTGGGGAACATGAGCAGAAGG - Intronic
1107939188 13:45369404-45369426 CTTTAGGGAGGAAGAGTAGAAGG - Intergenic
1108511368 13:51158936-51158958 CTATGCAGAAGAAGCGGAGAAGG - Intergenic
1110279457 13:73675922-73675944 TCTTGGGGAGGAAGCACAGAGGG + Intergenic
1111965656 13:94859056-94859078 GTTTGTGGAAGAAGCGCATCTGG - Intergenic
1112972186 13:105273911-105273933 CTATGGGGCTGAAGAGCAGATGG - Intergenic
1113330610 13:109323342-109323364 CTTGGGGGAAGAAGGGGAGGGGG + Intergenic
1113774691 13:112936519-112936541 TTTTGGGGAAGAAGAGAAGGAGG + Intronic
1115665582 14:35541620-35541642 CTTTAGGGAAGCACTGCAGATGG + Intronic
1120862456 14:89267067-89267089 CTGTAGGGAAGAAGGGAAGAAGG - Intronic
1122235816 14:100330154-100330176 CTGTGGGGAAGAAGCCGAGCCGG - Exonic
1122723351 14:103734664-103734686 CTTTGGTGATGAAGGGAAGAAGG + Exonic
1124649597 15:31465079-31465101 CTTTGTGGATGAGGCTCAGAAGG - Intergenic
1125222554 15:37355937-37355959 CCTTGAGGAAAAAGAGCAGAAGG - Intergenic
1126371926 15:47956427-47956449 CTTGAGGGAGGAAGAGCAGAGGG - Intergenic
1126746258 15:51829379-51829401 CTTTTGTAAAGAAGCGCACATGG - Intergenic
1128185463 15:65640400-65640422 CTCTGGGGAAGAGAAGCAGAAGG - Intronic
1128700947 15:69803859-69803881 CTTTGGGGAGGAAGTGCAGGAGG + Intergenic
1129661325 15:77554628-77554650 CCTTGGGGAGCGAGCGCAGAAGG + Intergenic
1130876314 15:88017673-88017695 CTTTGGGGAATAGGGGGAGAGGG + Intronic
1131018284 15:89075751-89075773 GTATGGGGAAGAAGAGCAGCAGG + Intergenic
1131536565 15:93242185-93242207 ATTTGGGGAAGAGGCCCAGGAGG + Intergenic
1131880873 15:96860595-96860617 CTTTGGGGAAGTATCTTAGAGGG - Intergenic
1140232436 16:73128739-73128761 ATTTGGGGAACAAGCGGAGAAGG - Intronic
1141109940 16:81264000-81264022 TCTAGGGGAGGAAGCGCAGACGG + Intronic
1143307264 17:5957359-5957381 GTTGGGGGAAGCAGAGCAGATGG + Intronic
1146883445 17:36456125-36456147 CTTTGGGAAGGAAGGACAGAAGG + Intergenic
1148553732 17:48565433-48565455 CTTTGGGGAGCAGGCACAGAGGG - Intronic
1149586354 17:57790221-57790243 CTTTGGGACAGAGGCGCAGGTGG - Intergenic
1150008651 17:61485753-61485775 CTTTGGGGAAGGAGCAATGAGGG - Intergenic
1150341046 17:64367665-64367687 TTTTGTGGTAGAAGCCCAGATGG - Intronic
1151179594 17:72317317-72317339 ATTTGGGGAAGAAGGGCCAAGGG + Intergenic
1151652861 17:75480931-75480953 CTGTGGCGAGGAAGCTCAGAAGG + Intronic
1153628943 18:7050426-7050448 CTGTGGGGAAGATGCTCTGAAGG + Intronic
1154185756 18:12181634-12181656 CTCTGGGGGAGAAGCCAAGATGG + Intergenic
1156350078 18:36296291-36296313 TTTGGGGGAGGAAGGGCAGATGG - Intergenic
1158224307 18:55184630-55184652 CTTGGGGGAAGAAGAGGAGCTGG + Intergenic
1160336424 18:78044365-78044387 CTTTGGGGAATAAGGGTAGTAGG - Intergenic
1161198485 19:3000723-3000745 CCTTGGGGAAGGAGAGCAGCAGG + Exonic
1165293798 19:34909734-34909756 GGTTGGGGGAGAAGCACAGAGGG - Intergenic
1166371504 19:42303822-42303844 CTCTGGGGAGGAAGAGGAGAAGG + Intronic
1166709801 19:44929405-44929427 CTGTGGGGAAGTAAAGCAGAAGG + Intergenic
926316364 2:11713146-11713168 CTTTGGGGAAGACATGAAGATGG + Intronic
928033513 2:27800910-27800932 ATTTGGGGAGGACGTGCAGAGGG + Intronic
928651218 2:33405554-33405576 CTTTGGGGAACATGCCCAGCTGG + Intergenic
929655161 2:43723625-43723647 CTTTGGGAAGAAAACGCAGAGGG + Intronic
932471697 2:71963365-71963387 CGTTGGGGATGAAACCCAGAGGG - Intergenic
932569736 2:72932295-72932317 CCTTGGGGAGGAGGTGCAGAGGG - Intronic
932577987 2:72973153-72973175 CTTTGGAGAAGAAAAGCAGGAGG + Intronic
934035840 2:88087961-88087983 CTTTGGGGAGGAGGAGCAGAAGG + Exonic
936079330 2:109421644-109421666 CCCTGGGGGAGAAGCCCAGAGGG - Intronic
939857466 2:147377478-147377500 CTATGGGGAGGAAGAGAAGAGGG - Intergenic
943619828 2:190136614-190136636 CTTTGGGGGAGAATAGCTGAAGG - Intronic
943921358 2:193710916-193710938 TTTTGGGGGAGAAGCCAAGATGG - Intergenic
946659241 2:221981762-221981784 TTTTGGGGAAGAATGGGAGAAGG - Intergenic
948403336 2:237700297-237700319 CTCAGGGGAAGAATCGCACAAGG + Intronic
1169143133 20:3237292-3237314 CCTTGGGTAAGAATCCCAGAGGG + Intronic
1173229561 20:41183586-41183608 CTTTGGGCAAGAAGCACTGGTGG - Exonic
1174069151 20:47887832-47887854 CTCTGGGGAGGAGGCGCAGCTGG + Intergenic
1174716273 20:52762147-52762169 CTTTGGGGAAGAAAGGCACAAGG - Intergenic
1175013836 20:55766969-55766991 CTCTGGGGCAGAGGAGCAGAGGG - Intergenic
1176240980 20:64075736-64075758 CGTGGGGGAAGAAGAGCAGGGGG - Intronic
1176457823 21:6928780-6928802 CTCTGGGGACGGAGAGCAGAGGG + Intergenic
1176835995 21:13793864-13793886 CTCTGGGGACGGAGAGCAGAGGG + Intergenic
1178350407 21:31869131-31869153 CCTTAGGAAAGAAGCACAGAGGG + Intergenic
1179437682 21:41373576-41373598 CTGTGGGGCTGAAGGGCAGAGGG - Intronic
1179816020 21:43906863-43906885 CTGGGTGGAAGAAGCGCAGTGGG + Intronic
1180047117 21:45312496-45312518 CATTGGAGAAGATGCACAGATGG + Intergenic
1180068807 21:45425885-45425907 CTTTGGGCAAGAAGGACAGCCGG - Intronic
1181858552 22:25800487-25800509 ATTTGGGGAAGGACCCCAGAAGG + Intronic
1182181113 22:28349110-28349132 CTTTGGAAAAGCAGAGCAGAAGG + Intronic
1182558954 22:31143915-31143937 ATCTGGGGAGGAAGCCCAGAAGG + Intergenic
1182617448 22:31597267-31597289 CTCTGGAGAAAAAGGGCAGAGGG + Intronic
1183420892 22:37710625-37710647 CCTTGGGGAAGGAGTGCAAATGG - Intronic
1185109238 22:48891648-48891670 CTCTGAGGAAGAAGAGCAGTGGG + Intergenic
950556117 3:13696990-13697012 CTTTGGAGATGAGGCCCAGATGG - Intergenic
952267859 3:31803547-31803569 CTTAGGGGAAGTTGCGCAAAGGG - Intronic
954185115 3:48911045-48911067 CACTGGGGAAGGAGCGTAGATGG + Intergenic
954806857 3:53225577-53225599 TTCTGGGGAAGAAGCGTGGAGGG - Intronic
955924200 3:63989887-63989909 CTTTGGGGGAGAATAGAAGAGGG + Intronic
956022978 3:64951756-64951778 CTTTGGGGAAGCTGAGAAGAAGG + Intergenic
957719417 3:83974117-83974139 CTTTGGGGAATAAAGGCAGGGGG - Intergenic
957752398 3:84438436-84438458 TTTTAAGGAAGAAGCTCAGAAGG - Intergenic
958949534 3:100401317-100401339 CTTCAGGAAAGAAGGGCAGATGG + Exonic
959344585 3:105177295-105177317 CTTCTGGGGAGAAGGGCAGAGGG + Intergenic
960002976 3:112752161-112752183 CTTTGGGGGAGAAGAGCTGAAGG + Intronic
960183627 3:114612115-114612137 CTTTTGGAAAGAAGCAAAGATGG - Intronic
960465451 3:117992374-117992396 CTTTGGGAAACAAATGCAGAAGG - Intergenic
961472773 3:127126879-127126901 CTTTGTGGGAGAAGGGAAGAGGG - Intergenic
962070989 3:132033958-132033980 CATAGAGGAAGAAGCGCTGAAGG + Intronic
963732045 3:148984451-148984473 CTTTGAGGAAGGAGAGGAGAGGG - Intergenic
968124082 3:196145664-196145686 CATTGGGCAAGAAGAGCACATGG - Intergenic
970561029 4:17282450-17282472 CTCTGGGGAATAAATGCAGAGGG - Intergenic
971555399 4:28007611-28007633 CTTTGGAGAAGACGGGGAGACGG + Intergenic
973663827 4:53137291-53137313 CTTTGGGAAAGAAGTGAGGAAGG - Intronic
974436220 4:61860623-61860645 CTCTGGGGAAGGACCGCAGATGG - Intronic
974588285 4:63910226-63910248 CTTTGTGGAAGACACGGAGAAGG + Intergenic
977459505 4:97307759-97307781 CTTTGGGGAAGAAGAGGTAAGGG + Intronic
977477477 4:97530826-97530848 CTTTGGGGAGGGAGAGCAGGGGG + Intronic
977784209 4:101014121-101014143 CTTTGGGGAACCAGCATAGAAGG - Intergenic
982083776 4:151814804-151814826 CTTTGGAGAATAAATGCAGAAGG + Intergenic
982406543 4:155026780-155026802 CTTAGGGGAGGAAGGGAAGAGGG - Intergenic
985753933 5:1701882-1701904 CTTTGTGGATGAAGACCAGAAGG + Intergenic
987182769 5:15385052-15385074 CTCTGGGGGAGAAGGGGAGAGGG - Intergenic
988450413 5:31336909-31336931 CTTAGGGCAAGAAGGGAAGAGGG + Intergenic
989272434 5:39549029-39549051 CTTTGAGGAAGATGGGCTGAAGG + Intergenic
989547578 5:42692380-42692402 CTTTTGGGAGTAAGAGCAGAGGG + Intronic
990664899 5:58061335-58061357 CTTTGGGAAAGAGCAGCAGAAGG - Intergenic
990976342 5:61564854-61564876 CTTTGGGAATGAAGGGGAGAAGG - Intergenic
992173533 5:74127412-74127434 CTTGGGGAAAGAGGCTCAGATGG - Intergenic
992230617 5:74659920-74659942 CCTTGAGGATGAAGGGCAGAAGG + Intronic
993674636 5:90802219-90802241 TTTTGGGGGAGAAGGGGAGACGG + Intronic
996525343 5:124473429-124473451 CTTTCGGGAAGAGTCGGAGATGG - Intergenic
997162302 5:131621868-131621890 CTTTGGGGGAGAAGAGCAAAGGG - Intronic
997601380 5:135141049-135141071 CATTGGGGAAGACGCTCAGGCGG + Intronic
999182460 5:149679746-149679768 CTTCTGGGAAGAAGGGGAGAGGG + Intergenic
999762019 5:154709687-154709709 GTGTGGGAAAGAGGCGCAGATGG + Intergenic
1000125446 5:158239361-158239383 CCTTTGGGAAAAAGTGCAGATGG + Intergenic
1001283336 5:170403968-170403990 CTGTGGGGAAGAAGCAGAGTGGG + Intronic
1001435004 5:171693400-171693422 CCTTGGGGCAGAAGCCCAGCTGG + Intergenic
1002450908 5:179318013-179318035 CTTTGGGGAGGACGTGCAGGTGG - Intronic
1003948249 6:11094291-11094313 CTTGGGGGCAGAAGGGCAGTCGG - Exonic
1006020823 6:31116636-31116658 CTTTGGTGAAGTAGCCCACAGGG + Exonic
1006108113 6:31728784-31728806 CTTTGGGGAAGAATTGAGGATGG - Intronic
1006225957 6:32536259-32536281 CTTTAGGGAAGAAGGGCTGTGGG - Intergenic
1006720517 6:36147266-36147288 CCTTGTGGAAGAAGGGTAGATGG - Intergenic
1007111966 6:39317998-39318020 GTCTGGGGAAGAGGAGCAGAGGG - Intronic
1007742733 6:44022708-44022730 CTTTGGGGAAGAGGAGCAAGTGG - Intergenic
1008140449 6:47825762-47825784 TTATGGGGAAGAAGGGAAGAAGG + Intronic
1011114441 6:83874703-83874725 CCTTGGGGAAGAAGCGATCAGGG - Intronic
1012602803 6:101118786-101118808 TTTTGGGGAAGAAGTTCTGAGGG - Intergenic
1014647622 6:123994031-123994053 CTCTGGGGAAGAAGCAGTGATGG - Intronic
1015182897 6:130379728-130379750 CTTAGGGGAAAGAGCACAGATGG + Intronic
1015402523 6:132802224-132802246 CTTTGGGGAACCAGGGCAGATGG - Intergenic
1016792885 6:148084544-148084566 CTTTGGGGAAAAAAATCAGATGG - Intergenic
1019162325 6:170076858-170076880 CTGTGGGGAAGAAGAGAGGAGGG - Intergenic
1019870509 7:3756821-3756843 TTTTGGGGAAGAATCCCACAGGG + Intronic
1020112593 7:5455961-5455983 CACTGGGGAAGGAGCACAGAGGG - Intronic
1020898847 7:13976827-13976849 CTTAGGGAAAGGAACGCAGAAGG + Intronic
1022280263 7:28901032-28901054 CTTTGGGGAAGAGGTGGAAATGG - Intergenic
1024022338 7:45383510-45383532 TTTTGGGGGAGAAGCCAAGATGG - Intergenic
1024094948 7:45976010-45976032 CTTTGAGGATGATGCCCAGAGGG + Intergenic
1024858975 7:53815548-53815570 CTATGGGAAAGAAGGGAAGATGG - Intergenic
1025857347 7:65293828-65293850 CTTTGGGGAATTAGGGCAAAGGG - Intergenic
1026566874 7:71496554-71496576 CTTCGGGGAAGGAGGGCAGGTGG - Intronic
1028283875 7:88970097-88970119 CTTTGGGGAAGAAAGGTGGATGG - Intronic
1029539910 7:101176585-101176607 CTATGGGGAAGAGGGGCAGAAGG - Intronic
1029724970 7:102396670-102396692 CTTTGGGGAGGAGGAGGAGAAGG + Intronic
1030275935 7:107721809-107721831 CTTTGGGGTAGGAATGCAGATGG - Intergenic
1030349534 7:108468657-108468679 CTGGGGGGAAAAAGCTCAGAGGG + Intergenic
1031749125 7:125547892-125547914 GTTTGGGGAAGAAAATCAGATGG - Intergenic
1032408953 7:131678937-131678959 CAATGGGGAAGAAGGGGAGAGGG + Intergenic
1033666523 7:143445909-143445931 CTTTTAGAAAGATGCGCAGATGG - Intergenic
1034113301 7:148559386-148559408 CTATGGGGAAGAAGGGAATAGGG - Intergenic
1036148820 8:6279527-6279549 CTTTGGAGGAGGAGCACAGACGG - Intergenic
1039509271 8:38077841-38077863 CACTGGGGAAGCAGCCCAGATGG - Intergenic
1039747681 8:40444503-40444525 CTTTAGGGAGGAAGGGCATATGG + Intergenic
1042970499 8:74402688-74402710 CTTTGGGGAAGGAGCCAAGATGG - Intronic
1044232270 8:89793233-89793255 CTTTAGGGAAGAACTTCAGAAGG + Intergenic
1045484890 8:102623139-102623161 GTTTGGGGGAGAAGGGTAGATGG - Intergenic
1045712206 8:104998056-104998078 CTTTGGGGAAGGATGCCAGAAGG + Intronic
1046550459 8:115709384-115709406 CTTTAGGGAGGAAGACCAGAGGG - Intronic
1048044056 8:130756700-130756722 CCTTGGGGAGGAAGAGGAGATGG + Intergenic
1049298594 8:141856844-141856866 GTTTGGGGAACAGGCGCAGTGGG + Intergenic
1049800052 8:144513481-144513503 CTTTGGGGAAGACAGGCAGATGG + Intronic
1049804811 8:144534019-144534041 GTATGGGGCAGCAGCGCAGAGGG - Intronic
1051697832 9:19788620-19788642 CGTCGGGGGAGACGCGCAGAGGG - Intergenic
1052401456 9:28005468-28005490 CTGTGGGGAAGAAAAGTAGAGGG - Intronic
1052733396 9:32315651-32315673 GTTGGGGGAAGAAGGGAAGAAGG + Intergenic
1054930717 9:70632316-70632338 GTTTGGGGAAGAAGTGAATAAGG - Intronic
1057815798 9:98293278-98293300 CTTTGGAGGAAAAGCACAGAAGG - Intronic
1060996412 9:127876873-127876895 CTGTGGGGCCGAAGCCCAGAGGG + Intronic
1061533217 9:131230810-131230832 CTTTGGGGGAGAAGGCAAGAGGG - Intronic
1186897638 X:14020359-14020381 CTTTGGGGAAGAAGCGCAGAAGG + Exonic
1189150746 X:38703798-38703820 CTTTGGGGAAGAAGAAAAGAAGG + Intergenic
1190734698 X:53248569-53248591 CTTTGGGGCAGAAGGGTACAGGG + Intronic
1191095624 X:56670541-56670563 ATTTGGGGAAGAAATGTAGATGG - Intergenic
1196733086 X:118960904-118960926 CTTTGGGGAAGAAGTACAAATGG + Intergenic
1199532708 X:148868266-148868288 CTTGGGGGAAGAAGAGCTGGGGG - Intronic