ID: 1186898580

View in Genome Browser
Species Human (GRCh38)
Location X:14029939-14029961
Sequence GGAAGTCCCCCCCTGTGTCG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 59}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186898575_1186898580 11 Left 1186898575 X:14029905-14029927 CCGGTGCGGAACACGTGGCGTGG 0: 1
1: 0
2: 0
3: 1
4: 35
Right 1186898580 X:14029939-14029961 GGAAGTCCCCCCCTGTGTCGCGG 0: 1
1: 0
2: 0
3: 3
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186898580 Original CRISPR GGAAGTCCCCCCCTGTGTCG CGG Intergenic
904828108 1:33288775-33288797 GGAAGTCCACCCCTGACTCTAGG - Intronic
905405248 1:37728171-37728193 GCAAGTCGTCCCCTGTGTCTGGG + Intronic
914431148 1:147620869-147620891 TTAAGTCCCCCCCTGTTTTGGGG + Exonic
917928262 1:179806678-179806700 GAAAGGCCCCCCCTGGGTGGGGG - Intronic
1068866019 10:61896850-61896872 GGAAGTCTCCATCTGTATCGAGG + Intergenic
1069360201 10:67633154-67633176 GGAGGTCCCACCCTGTGAGGAGG - Intronic
1069758046 10:70785702-70785724 GGAAGCCGACCCCTGTGTGGTGG - Intergenic
1076207695 10:128616217-128616239 GGAAGTACCTCCCTGTTTCATGG + Intergenic
1076899309 10:133329269-133329291 GGAAGTCTCCCCCTGCTTCGTGG - Intronic
1079668463 11:23135956-23135978 GGAAGTCCCACCCAGTGGGGAGG + Intergenic
1084632122 11:70359916-70359938 GGAAGAAGGCCCCTGTGTCGAGG - Intronic
1085326548 11:75610855-75610877 GGTAGTCCCCCACTGAGACGTGG + Intronic
1107556137 13:41518077-41518099 GGAAGTCCCCTAGTGTGTAGGGG + Intergenic
1119846543 14:77834725-77834747 GGAAGCCCACCCATGTGTCCAGG - Intronic
1121921614 14:97887354-97887376 GAAAGTTCCCCACTGAGTCGTGG - Intergenic
1122262673 14:100532011-100532033 GGAAGGCCCACTCTGTGCCGGGG - Intergenic
1122635082 14:103126029-103126051 GAAAGTCCCCCTCTGTGTGGCGG + Intronic
1122746416 14:103899606-103899628 TGAAGCCCACCCCTGTGACGAGG - Intergenic
1127877365 15:63122413-63122435 GGAGGTCACCGCCTGTCTCGGGG + Intronic
1132536550 16:484288-484310 GGAAGGACCTCCCTGTGTGGGGG - Intronic
1132542285 16:516149-516171 GCAAGTCCCCTCCTGGGTAGAGG + Intronic
1137668147 16:50263638-50263660 GGAACCCCCCTCCTGTGTCCAGG + Intronic
1138016726 16:53434905-53434927 GGAAGTCCCCACCCCTCTCGGGG - Intronic
1152897411 17:82920807-82920829 GGAAGGGCCCTCCTGTGTTGGGG - Intronic
1162385424 19:10357963-10357985 GGAAGCCCCCCACTGTGCCCAGG + Intronic
1165397777 19:35576523-35576545 GGAAGTCCCCCCTCCTGTCCAGG - Intergenic
925018138 2:547247-547269 GGCTGTCCCTCCCTGTGTAGCGG - Intergenic
925018151 2:547304-547326 GGCTGTCCCTCCCTGTGTAGCGG - Intergenic
925018164 2:547361-547383 GGCTGTCCCTCCCTGTGTAGCGG - Intergenic
925018177 2:547418-547440 GGCTGTCCCTCCCTGTGTAGCGG - Intergenic
925018189 2:547475-547497 GGCTGTCCCTCCCTGTGTAGCGG - Intergenic
925018238 2:547702-547724 GGCTGTCCCTCCCTGTGTAGTGG - Intergenic
926371001 2:12178584-12178606 CGAACTCCCTCCCTGTGTGGAGG + Intergenic
1179981053 21:44896228-44896250 GGAATTCCCTACCTGTGTGGTGG - Intronic
1182071950 22:27469970-27469992 GGAAGTCACCCTCCGTGTGGAGG - Intergenic
959506729 3:107164464-107164486 GGAGGTCCCACCCTGTGAGGAGG - Intergenic
959605467 3:108236898-108236920 GGAGGTCCCACCCTGTGAGGAGG + Intergenic
961202411 3:125055603-125055625 GGAGGGTCCCCGCTGTGTCGCGG + Exonic
962944754 3:140157007-140157029 GCAAGACCTCCCCTGTGTCCTGG - Intronic
974986083 4:69027189-69027211 GGAAGTCCCACCCAGTGAGGAGG + Intronic
993651577 5:90529282-90529304 GGAAGTTCTTCCCTGTCTCGGGG + Intronic
995428599 5:112050201-112050223 GGAAGTCCCACCCAGTGAGGAGG - Intergenic
996407384 5:123119028-123119050 AGAAGACCCCACCTGTGTAGGGG + Intronic
1006050906 6:31343359-31343381 TGATGTTCCCCCCTGTGTCCAGG - Intronic
1006126910 6:31844866-31844888 TCAAGTCCTCCCCTGTGTGGTGG + Intergenic
1007609845 6:43142277-43142299 GGAGGCCCCCCTCTATGTCGTGG + Exonic
1014674713 6:124349295-124349317 GGAAGTTCCCGCCTTTGTAGGGG - Intronic
1016338950 6:143040147-143040169 TGAAGTCCCCCACAGTGTCATGG - Intergenic
1019192068 6:170257527-170257549 GGAAGGCCCCACCTGTGCCATGG - Intergenic
1024165158 7:46723320-46723342 GGAAATCCCACCCAGTGACGAGG - Intronic
1040107592 8:43549349-43549371 AGAAGTCCCCCCCGGTGACGGGG - Intergenic
1043233340 8:77830341-77830363 GGAGGTCCCACCCTGTGAGGAGG - Intergenic
1044125835 8:88457271-88457293 GGAAGTTCCACCCTGTGAGGAGG - Intergenic
1053914731 9:42937205-42937227 GGTAGTAGCCCCCTGTGTGGGGG + Intergenic
1057790148 9:98119212-98119234 GGGAGCCCCGCCCTGTGTCCCGG - Intronic
1060667595 9:125441722-125441744 GGAAGCCCAGCCCTGTGTCCGGG - Intronic
1062325233 9:136009643-136009665 CGAAGCCCACCCCTGTGGCGAGG - Exonic
1186898580 X:14029939-14029961 GGAAGTCCCCCCCTGTGTCGCGG + Intergenic
1189581694 X:42413815-42413837 GGAAGACCCACCCTGTGAAGAGG + Intergenic
1192923667 X:75734251-75734273 GGAGGTCCCCCCCAGTGAAGAGG + Intergenic
1196152809 X:112393050-112393072 GGAAGTCCCACCCAGTGAAGAGG + Intergenic
1196388974 X:115189980-115190002 GGAAGGCACCGACTGTGTCGGGG + Exonic
1197633284 X:128886653-128886675 GGAAGACCCCCCCTTTATCTGGG - Intergenic