ID: 1186900100

View in Genome Browser
Species Human (GRCh38)
Location X:14045340-14045362
Sequence ATACTGCTATAGATGGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186900100_1186900111 28 Left 1186900100 X:14045340-14045362 CCCTGCCCCATCTATAGCAGTAT No data
Right 1186900111 X:14045391-14045413 CAGGAGACATTTGTCAATGTTGG No data
1186900100_1186900107 9 Left 1186900100 X:14045340-14045362 CCCTGCCCCATCTATAGCAGTAT No data
Right 1186900107 X:14045372-14045394 GGAGGCAATTTTTTCCCACCAGG No data
1186900100_1186900106 -9 Left 1186900100 X:14045340-14045362 CCCTGCCCCATCTATAGCAGTAT No data
Right 1186900106 X:14045354-14045376 TAGCAGTATTTCTCAACTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186900100 Original CRISPR ATACTGCTATAGATGGGGCA GGG (reversed) Intergenic
No off target data available for this crispr